grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for marker "AY244508_316-5A" from the experiment "Haplotype polymorphism in polyploid wheats and their diploid ancestors".

E.g., Germplasm PI 350731, Marker/locus BE496863_82-7B.

Items 26 to 50 of 52.       Previous | of 3 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Germplasm
PI 410595 Pakistan compactum Pakistan 1 AY244508_316-5A G View all "PI 410595" genotypes
PI 428020 "Diyarbakir, Turkey" dicoccoides Turkey 1 AY244508_316-5A G View all "PI 428020" genotypes
PI 428020 "Diyarbakir, Turkey" dicoccoides Turkey 1 AY244508_316-5A ---CTCGAGAGGTAGCTGTC View all "PI 428020" genotypes
PI 428027 "Diyarbakir, Turkey" dicoccoides Turkey 1 AY244508_316-5A G View all "PI 428027" genotypes
PI 428027 "Diyarbakir, Turkey" dicoccoides Turkey 1 AY244508_316-5A C-ACTCGAGA-GTAGCTGTC View all "PI 428027" genotypes
PI 428053 "Diyarbakir, Turkey" dicoccoides Turkey 1 AY244508_316-5A --ACTCGAGA-GTAGCTGTC View all "PI 428053" genotypes
PI 428053 "Diyarbakir, Turkey" dicoccoides Turkey 1 AY244508_316-5A G View all "PI 428053" genotypes
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 AY244508_316-5A G View all "PI 428064" genotypes
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 AY244508_316-5A --ACTCGAGAGGTAGCTGTC View all "PI 428064" genotypes
PI 428073 "Diyarbakir, Turkey" dicoccoides Turkey 1 AY244508_316-5A G View all "PI 428073" genotypes
PI 428073 "Diyarbakir, Turkey" dicoccoides Turkey 1 AY244508_316-5A C-ACTCGAGA-GTAGCTGTC View all "PI 428073" genotypes
PI 428082 "Diyarbakir, Turkey" dicoccoides Turkey 1 AY244508_316-5A --ACTCGAGAGGTAGCTGTC View all "PI 428082" genotypes
PI 428082 "Diyarbakir, Turkey" dicoccoides Turkey 1 AY244508_316-5A G View all "PI 428082" genotypes
PI 428083 "Diyarbakir, Turkey" dicoccoides Turkey 1 AY244508_316-5A C-ACTCGAGA-GTAGCTGTC View all "PI 428083" genotypes
PI 428083 "Diyarbakir, Turkey" dicoccoides Turkey 1 AY244508_316-5A G View all "PI 428083" genotypes
PI 428086 "Diyarbakir, Turkey" dicoccoides Turkey 1 AY244508_316-5A G View all "PI 428086" genotypes
PI 428086 "Diyarbakir, Turkey" dicoccoides Turkey 1 AY244508_316-5A C-ACTCGAGA-GTAGCTGTC View all "PI 428086" genotypes
RL5402 Eric Kerber   Unknown 1 AY244508_316-5A G View all "RL5402" genotypes
RL5402 Eric Kerber   Unknown 1 AY244508_316-5A C-ACTCGAGA-GTAGCTGTC View all "RL5402" genotypes
Sn32 E.R. Sears   Unknown 1 AY244508_316-5A G View all "Sn32" genotypes
Sn32 E.R. Sears   Unknown 1 AY244508_316-5A C-ACTAGAGAGGTAGCTGTC View all "Sn32" genotypes
W7984 CIMMYT   Mexico 1 AY244508_316-5A G View all "W7984" genotypes
W7984 CIMMYT   Mexico 1 AY244508_316-5A GGTCAACTTGTCATGAAGCC View all "W7984" genotypes
Yangxian Yangqianmai "Shaanxi, China"   China 1 AY244508_316-5A G View all "Yangxian Yangqianmai" genotypes
Yangxian Yangqianmai "Shaanxi, China"   China 1 AY244508_316-5A ---CTCGAGAGGTAGCTGTC View all "Yangxian Yangqianmai" genotypes
[ Download ]