grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for marker "AF085169_14-3B" from the experiment "Haplotype polymorphism in polyploid wheats and their diploid ancestors".

E.g., Germplasm PI 350731, Marker/locus BE496863_82-7B.

Items 1 to 25 of 50.       of 2 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Germplasm
405a Iran spelta Iran 1 AF085169_14-3B A View all "405a" genotypes
405a Iran spelta Iran 1 AF085169_14-3B --GTTATTAGCATGAATGTT View all "405a" genotypes
Chinese Spring China   China 1 AF085169_14-3B A View all "Chinese Spring" genotypes
Chinese Spring China   China 1 AF085169_14-3B --GTTATTAGCATGAATGTT View all "Chinese Spring" genotypes
CIMMYT 161725_0 CIMMYT   Mexico 1 AF085169_14-3B G View all "CIMMYT 161725_0" genotypes
CIMMYT 161725_0 CIMMYT   Mexico 1 AF085169_14-3B -------------------- View all "CIMMYT 161725_0" genotypes
CIMMYT 62052_4 CIMMYT   Mexico 1 AF085169_14-3B A View all "CIMMYT 62052_4" genotypes
CIMMYT 62052_4 CIMMYT   Mexico 1 AF085169_14-3B -------------------- View all "CIMMYT 62052_4" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 AF085169_14-3B -------------------- View all "CIMMYT 62056_4" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 AF085169_14-3B G View all "CIMMYT 62056_4" genotypes
G 2844 "Diyarbakir, Turkey" dicoccoides Turkey 1 AF085169_14-3B A View all "G 2844" genotypes
G 2844 "Diyarbakir, Turkey" dicoccoides Turkey 1 AF085169_14-3B -------------------- View all "G 2844" genotypes
IWA 10993 Iran   Iran 1 AF085169_14-3B -------------------- View all "IWA 10993" genotypes
IWA 10993 Iran   Iran 1 AF085169_14-3B A View all "IWA 10993" genotypes
PI 119325 Turkey   Turkey 1 AF085169_14-3B A View all "PI 119325" genotypes
PI 119325 Turkey   Turkey 1 AF085169_14-3B -------------------- View all "PI 119325" genotypes
PI 166305 Turkey compactum Turkey 1 AF085169_14-3B A View all "PI 166305" genotypes
PI 166305 Turkey compactum Turkey 1 AF085169_14-3B --GTTATTAGCATGAATGTT View all "PI 166305" genotypes
PI 166698 Turkey   Turkey 1 AF085169_14-3B A View all "PI 166698" genotypes
PI 166698 Turkey   Turkey 1 AF085169_14-3B CTGTTATTAGCATGAATGTT View all "PI 166698" genotypes
PI 166792 Turkey   Turkey 1 AF085169_14-3B A View all "PI 166792" genotypes
PI 166792 Turkey   Turkey 1 AF085169_14-3B --GTTATTAGCATGAATGTT View all "PI 166792" genotypes
PI 410595 Pakistan compactum Pakistan 1 AF085169_14-3B A View all "PI 410595" genotypes
PI 410595 Pakistan compactum Pakistan 1 AF085169_14-3B -------------------- View all "PI 410595" genotypes
PI 428020 "Diyarbakir, Turkey" dicoccoides Turkey 1 AF085169_14-3B A View all "PI 428020" genotypes
[ Download ]