grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for marker "AF085169_25-3B" from the experiment "Haplotype polymorphism in polyploid wheats and their diploid ancestors".

E.g., Germplasm PI 350731, Marker/locus BE496863_82-7B.

Items 26 to 50 of 50.       Previous | of 2

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Germplasm
IWA 10993 Iran   Iran 1 AF085169_25-3B A View all "IWA 10993" genotypes
IWA 10993 Iran   Iran 1 AF085169_25-3B -------------------- View all "IWA 10993" genotypes
PI 410595 Pakistan compactum Pakistan 1 AF085169_25-3B G View all "PI 410595" genotypes
PI 410595 Pakistan compactum Pakistan 1 AF085169_25-3B -------------------- View all "PI 410595" genotypes
PI 166792 Turkey   Turkey 1 AF085169_25-3B --GTTATTAGCATGAATGTT View all "PI 166792" genotypes
PI 166792 Turkey   Turkey 1 AF085169_25-3B G View all "PI 166792" genotypes
PI 166305 Turkey compactum Turkey 1 AF085169_25-3B --GTTATTAGCATGAATGTT View all "PI 166305" genotypes
PI 166305 Turkey compactum Turkey 1 AF085169_25-3B G View all "PI 166305" genotypes
PI 166698 Turkey   Turkey 1 AF085169_25-3B G View all "PI 166698" genotypes
G 2844 "Diyarbakir, Turkey" dicoccoides Turkey 1 AF085169_25-3B -------------------- View all "G 2844" genotypes
PI 428086 "Diyarbakir, Turkey" dicoccoides Turkey 1 AF085169_25-3B --GTTATTAGCATGGATGTT View all "PI 428086" genotypes
PI 428086 "Diyarbakir, Turkey" dicoccoides Turkey 1 AF085169_25-3B A View all "PI 428086" genotypes
PI 428083 "Diyarbakir, Turkey" dicoccoides Turkey 1 AF085169_25-3B A View all "PI 428083" genotypes
PI 428083 "Diyarbakir, Turkey" dicoccoides Turkey 1 AF085169_25-3B -------------------- View all "PI 428083" genotypes
PI 428073 "Diyarbakir, Turkey" dicoccoides Turkey 1 AF085169_25-3B G View all "PI 428073" genotypes
PI 428073 "Diyarbakir, Turkey" dicoccoides Turkey 1 AF085169_25-3B -------------------- View all "PI 428073" genotypes
PI 428053 "Diyarbakir, Turkey" dicoccoides Turkey 1 AF085169_25-3B A View all "PI 428053" genotypes
PI 428053 "Diyarbakir, Turkey" dicoccoides Turkey 1 AF085169_25-3B -------------------- View all "PI 428053" genotypes
PI 428020 "Diyarbakir, Turkey" dicoccoides Turkey 1 AF085169_25-3B A View all "PI 428020" genotypes
PI 428020 "Diyarbakir, Turkey" dicoccoides Turkey 1 AF085169_25-3B -------------------- View all "PI 428020" genotypes
Yangxian Yangqianmai "Shaanxi, China"   China 1 AF085169_25-3B -------------------- View all "Yangxian Yangqianmai" genotypes
G 2844 "Diyarbakir, Turkey" dicoccoides Turkey 1 AF085169_25-3B A View all "G 2844" genotypes
PI 166698 Turkey   Turkey 1 AF085169_25-3B CTGTTATTAGCATGAATGTT View all "PI 166698" genotypes
Sn32 E.R. Sears   Unknown 1 AF085169_25-3B A View all "Sn32" genotypes
Sn32 E.R. Sears   Unknown 1 AF085169_25-3B -------------------- View all "Sn32" genotypes
[ Download ]