grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for marker "AF085169_25-3B" from the experiment "Haplotype polymorphism in polyploid wheats and their diploid ancestors".

E.g., Germplasm PI 350731, Marker/locus BE496863_82-7B.

Items 26 to 50 of 50.       Previous | of 2

[ Download ]

Accession Name


& subtaxa

Country of


View All Genotypes on
CIMMYT 62056_4 CIMMYT   Mexico 1 AF085169_25-3B A View all "CIMMYT 62056_4" genotypes
W7984 CIMMYT   Mexico 1 AF085169_25-3B A View all "W7984" genotypes
PI 119325 Turkey   Turkey 1 AF085169_25-3B A View all "PI 119325" genotypes
Yecora Rojo CIMMYT   Mexico 1 AF085169_25-3B A View all "Yecora Rojo" genotypes
IWA 10993 Iran   Iran 1 AF085169_25-3B A View all "IWA 10993" genotypes
PI 428086 "Diyarbakir, Turkey" dicoccoides Turkey 1 AF085169_25-3B A View all "PI 428086" genotypes
PI 428083 "Diyarbakir, Turkey" dicoccoides Turkey 1 AF085169_25-3B A View all "PI 428083" genotypes
PI 428053 "Diyarbakir, Turkey" dicoccoides Turkey 1 AF085169_25-3B A View all "PI 428053" genotypes
PI 428020 "Diyarbakir, Turkey" dicoccoides Turkey 1 AF085169_25-3B A View all "PI 428020" genotypes
G 2844 "Diyarbakir, Turkey" dicoccoides Turkey 1 AF085169_25-3B A View all "G 2844" genotypes
Sn32 E.R. Sears   Unknown 1 AF085169_25-3B A View all "Sn32" genotypes
PI 166698 Turkey   Turkey 1 AF085169_25-3B CTGTTATTAGCATGAATGTT View all "PI 166698" genotypes
CIMMYT 62052_4 CIMMYT   Mexico 1 AF085169_25-3B G View all "CIMMYT 62052_4" genotypes
RL5406 Eric Kerber   Unknown 1 AF085169_25-3B G View all "RL5406" genotypes
RL5405 Eric Kerber   Unknown 1 AF085169_25-3B G View all "RL5405" genotypes
RL5403 Eric Kerber   Unknown 1 AF085169_25-3B G View all "RL5403" genotypes
RL5402 Eric Kerber   Unknown 1 AF085169_25-3B G View all "RL5402" genotypes
405a Iran spelta Iran 1 AF085169_25-3B G View all "405a" genotypes
Chinese Spring China   China 1 AF085169_25-3B G View all "Chinese Spring" genotypes
Yangxian Yangqianmai "Shaanxi, China"   China 1 AF085169_25-3B G View all "Yangxian Yangqianmai" genotypes
PI 410595 Pakistan compactum Pakistan 1 AF085169_25-3B G View all "PI 410595" genotypes
PI 166792 Turkey   Turkey 1 AF085169_25-3B G View all "PI 166792" genotypes
PI 166305 Turkey compactum Turkey 1 AF085169_25-3B G View all "PI 166305" genotypes
PI 166698 Turkey   Turkey 1 AF085169_25-3B G View all "PI 166698" genotypes
PI 428073 "Diyarbakir, Turkey" dicoccoides Turkey 1 AF085169_25-3B G View all "PI 428073" genotypes
[ Download ]