grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for marker "AF085169_25-3B" from the experiment "Haplotype polymorphism in polyploid wheats and their diploid ancestors".

E.g., Germplasm PI 350731, Marker/locus BE496863_82-7B.

Items 26 to 50 of 50.       Previous | of 2

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Germplasm
Yecora Rojo CIMMYT   Mexico 1 AF085169_25-3B A View all "Yecora Rojo" genotypes
Sn32 E.R. Sears   Unknown 1 AF085169_25-3B A View all "Sn32" genotypes
Sn32 E.R. Sears   Unknown 1 AF085169_25-3B -------------------- View all "Sn32" genotypes
RL5406 Eric Kerber   Unknown 1 AF085169_25-3B G View all "RL5406" genotypes
RL5406 Eric Kerber   Unknown 1 AF085169_25-3B -------------------- View all "RL5406" genotypes
RL5405 Eric Kerber   Unknown 1 AF085169_25-3B G View all "RL5405" genotypes
RL5405 Eric Kerber   Unknown 1 AF085169_25-3B -------------------- View all "RL5405" genotypes
RL5403 Eric Kerber   Unknown 1 AF085169_25-3B G View all "RL5403" genotypes
RL5403 Eric Kerber   Unknown 1 AF085169_25-3B -------------------- View all "RL5403" genotypes
RL5402 Eric Kerber   Unknown 1 AF085169_25-3B G View all "RL5402" genotypes
RL5402 Eric Kerber   Unknown 1 AF085169_25-3B -------------------- View all "RL5402" genotypes
405a Iran spelta Iran 1 AF085169_25-3B G View all "405a" genotypes
405a Iran spelta Iran 1 AF085169_25-3B --GTTATTAGCATGAATGTT View all "405a" genotypes
IWA 10993 Iran   Iran 1 AF085169_25-3B A View all "IWA 10993" genotypes
IWA 10993 Iran   Iran 1 AF085169_25-3B -------------------- View all "IWA 10993" genotypes
PI 410595 Pakistan compactum Pakistan 1 AF085169_25-3B G View all "PI 410595" genotypes
PI 410595 Pakistan compactum Pakistan 1 AF085169_25-3B -------------------- View all "PI 410595" genotypes
PI 119325 Turkey   Turkey 1 AF085169_25-3B A View all "PI 119325" genotypes
PI 119325 Turkey   Turkey 1 AF085169_25-3B -------------------- View all "PI 119325" genotypes
PI 166792 Turkey   Turkey 1 AF085169_25-3B --GTTATTAGCATGAATGTT View all "PI 166792" genotypes
PI 166792 Turkey   Turkey 1 AF085169_25-3B G View all "PI 166792" genotypes
PI 166305 Turkey compactum Turkey 1 AF085169_25-3B --GTTATTAGCATGAATGTT View all "PI 166305" genotypes
PI 166305 Turkey compactum Turkey 1 AF085169_25-3B G View all "PI 166305" genotypes
PI 166698 Turkey   Turkey 1 AF085169_25-3B G View all "PI 166698" genotypes
PI 166698 Turkey   Turkey 1 AF085169_25-3B CTGTTATTAGCATGAATGTT View all "PI 166698" genotypes
[ Download ]