grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm ""Diyarbakir, Turkey"" from the experiment "Haplotype polymorphism in polyploid wheats and their diploid ancestors".

E.g., Germplasm PI 350731, Marker/locus BE496863_82-7B.

Items 26 to 50 of 5,108.       Previous | of 205 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 BE607043_163-6A G View all "BE607043_163-6A" genotypes
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 BE607043_163-6A -------------------- View all "BE607043_163-6A" genotypes
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 BG274508_29-6A G View all "BG274508_29-6A" genotypes
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 BG274508_29-6A -------------------- View all "BG274508_29-6A" genotypes
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 BE606541_566-6B C View all "BE606541_566-6B" genotypes
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 BE606541_566-6B CTTGGCAAATTCGGGTGGCG View all "BE606541_566-6B" genotypes
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 BE606541_676-6B T View all "BE606541_676-6B" genotypes
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 BE606541_676-6B CTTGGCAAATTCGGGTGGCG View all "BE606541_676-6B" genotypes
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 BE490147_292-6A T View all "BE490147_292-6A" genotypes
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 BE490147_292-6A -------------------- View all "BE490147_292-6A" genotypes
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 BE490147_426-6A C View all "BE490147_426-6A" genotypes
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 BE490147_426-6A -------------------- View all "BE490147_426-6A" genotypes
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 BE490147_28-6B -------------------- View all "BE490147_28-6B" genotypes
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 BE490147_186-6B T View all "BE490147_186-6B" genotypes
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 BE490147_186-6B -------------------- View all "BE490147_186-6B" genotypes
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 BE490147_28-6B G View all "BE490147_28-6B" genotypes
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 BE489053_222-6A T View all "BE489053_222-6A" genotypes
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 BE489053_222-6A -------------------- View all "BE489053_222-6A" genotypes
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 BE495008_197-6A T View all "BE495008_197-6A" genotypes
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 BE495008_197-6A -------------------- View all "BE495008_197-6A" genotypes
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 BE495008_170-6B C View all "BE495008_170-6B" genotypes
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 BE495008_170-6B -------------------- View all "BE495008_170-6B" genotypes
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 BE637963_291-6A -------------------- View all "BE637963_291-6A" genotypes
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 BE495008_197-6A G View all "BE495008_197-6A" genotypes
PI 428064 "Diyarbakir, Turkey" dicoccoides Turkey 1 BE495008_197-6A -------------------- View all "BE495008_197-6A" genotypes
[ Download ]