grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "Turkey" from the experiment "Haplotype polymorphism in polyploid wheats and their diploid ancestors".

E.g., Germplasm PI 350731, Marker/locus BE496863_82-7B.

Items 51 to 75 of 7,890.       Previous | of 316 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
PI 166792 Turkey   Turkey 1 BE490147_28-6B -------------------- View all "BE490147_28-6B" genotypes
PI 166792 Turkey   Turkey 1 BE490147_426-6A T View all "BE490147_426-6A" genotypes
PI 166792 Turkey   Turkey 1 BE490147_426-6A -------------------- View all "BE490147_426-6A" genotypes
PI 166792 Turkey   Turkey 1 BE490147_186-6B -------------------- View all "BE490147_186-6B" genotypes
PI 166792 Turkey   Turkey 1 BE489623_348-6D A View all "BE489623_348-6D" genotypes
PI 166792 Turkey   Turkey 1 BE489623_348-6D -------------------- View all "BE489623_348-6D" genotypes
PI 166792 Turkey   Turkey 1 BE489623_197-6D C View all "BE489623_197-6D" genotypes
PI 166792 Turkey   Turkey 1 BE489623_197-6D -------------------- View all "BE489623_197-6D" genotypes
PI 166792 Turkey   Turkey 1 BE490147_186-6B C View all "BE490147_186-6B" genotypes
PI 166792 Turkey   Turkey 1 BE489623_115-6D -------------------- View all "BE489623_115-6D" genotypes
PI 166792 Turkey   Turkey 1 BE489623_181-6D C View all "BE489623_181-6D" genotypes
PI 166792 Turkey   Turkey 1 BE489623_181-6D -------------------- View all "BE489623_181-6D" genotypes
PI 166792 Turkey   Turkey 1 BE489623_266-6D G View all "BE489623_266-6D" genotypes
PI 166792 Turkey   Turkey 1 BE489623_266-6D -------------------- View all "BE489623_266-6D" genotypes
PI 166792 Turkey   Turkey 1 BE489623_115-6D A View all "BE489623_115-6D" genotypes
PI 166792 Turkey   Turkey 1 BE489623_157-6D A View all "BE489623_157-6D" genotypes
PI 166792 Turkey   Turkey 1 BE489053_62-6D -------------------- View all "BE489053_62-6D" genotypes
PI 166792 Turkey   Turkey 1 BE489053_62-6D A View all "BE489053_62-6D" genotypes
PI 166792 Turkey   Turkey 1 BE489053_222-6A CTGAGGTTGCTATATCTGGA View all "BE489053_222-6A" genotypes
PI 166792 Turkey   Turkey 1 BE489053_222-6A T View all "BE489053_222-6A" genotypes
PI 166792 Turkey   Turkey 1 BE405809_324-6D A View all "BE405809_324-6D" genotypes
PI 166792 Turkey   Turkey 1 BE405809_324-6D -------------------- View all "BE405809_324-6D" genotypes
PI 166792 Turkey   Turkey 1 BE405809_520-6D G View all "BE405809_520-6D" genotypes
PI 166792 Turkey   Turkey 1 BE405809_413-6D T View all "BE405809_413-6D" genotypes
PI 166792 Turkey   Turkey 1 BE405809_413-6D -------------------- View all "BE405809_413-6D" genotypes
[ Download ]