grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "Austria" from the experiment "Haplotype polymorphism in polyploid wheats and their diploid ancestors".

E.g., Germplasm PI 350731, Marker/locus BE496863_82-7B.

Items 26 to 50 of 7,746.       Previous | of 310 | Next

[ Download ]

Accession Name


& subtaxa

Country of


View All Genotypes on
PI 350731 Austria compactum Austria 1 BQ169448_34-6A C View all "BQ169448_34-6A" genotypes
PI 350731 Austria compactum Austria 1 BQ169448_163-6A G View all "BQ169448_163-6A" genotypes
PI 350731 Austria compactum Austria 1 BQ169448_163-6A -------------------- View all "BQ169448_163-6A" genotypes
PI 350731 Austria compactum Austria 1 BG274508_29-6A G View all "BG274508_29-6A" genotypes
PI 350731 Austria compactum Austria 1 BG274508_29-6A -------------------- View all "BG274508_29-6A" genotypes
PI 350731 Austria compactum Austria 1 BG274508_199-6D G View all "BG274508_199-6D" genotypes
PI 350731 Austria compactum Austria 1 BG274508_199-6D -------------------- View all "BG274508_199-6D" genotypes
PI 350731 Austria compactum Austria 1 BE606541_566-6B C View all "BE606541_566-6B" genotypes
PI 350731 Austria compactum Austria 1 BE606541_566-6B -----CAAATTCGGGTGGCG View all "BE606541_566-6B" genotypes
PI 350731 Austria compactum Austria 1 BE607043_163-6A G View all "BE607043_163-6A" genotypes
PI 350731 Austria compactum Austria 1 BE607043_163-6A -------------------- View all "BE607043_163-6A" genotypes
PI 350731 Austria compactum Austria 1 BE606541_251-6D C View all "BE606541_251-6D" genotypes
PI 350731 Austria compactum Austria 1 BE606541_251-6D GTAAGCCTCCGTCCCGCCCC View all "BE606541_251-6D" genotypes
PI 350731 Austria compactum Austria 1 BE606541_676-6B C View all "BE606541_676-6B" genotypes
PI 350731 Austria compactum Austria 1 BE606541_676-6B -----CAAATTCGGGTGGCG View all "BE606541_676-6B" genotypes
PI 350731 Austria compactum Austria 1 BE606541_208-6D A View all "BE606541_208-6D" genotypes
PI 350731 Austria compactum Austria 1 BE606541_208-6D GTAAGCCTCCGTCCCGCCCC View all "BE606541_208-6D" genotypes
PI 350731 Austria compactum Austria 1 BE606541_590-6D T View all "BE606541_590-6D" genotypes
PI 350731 Austria compactum Austria 1 BE606541_590-6D GTAAGCCTCCGTCCCGCCCC View all "BE606541_590-6D" genotypes
PI 350731 Austria compactum Austria 1 BE606541_297-6D A View all "BE606541_297-6D" genotypes
PI 350731 Austria compactum Austria 1 BE606541_297-6D GTAAGCCTCCGTCCCGCCCC View all "BE606541_297-6D" genotypes
PI 350731 Austria compactum Austria 1 BE606541_438-6D C View all "BE606541_438-6D" genotypes
PI 350731 Austria compactum Austria 1 BE606541_438-6D GTAAGCCTCCGTCCCGCCCC View all "BE606541_438-6D" genotypes
PI 350731 Austria compactum Austria 1 BE490147_426-6A C View all "BE490147_426-6A" genotypes
PI 350731 Austria compactum Austria 1 BE490147_426-6A -------------------- View all "BE490147_426-6A" genotypes
[ Download ]