grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "CIMMYT" from the experiment "Haplotype polymorphism in polyploid wheats and their diploid ancestors".

E.g., Germplasm PI 350731, Marker/locus BE496863_82-7B.

Items 26 to 50 of 7,738.       Previous | of 310 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
W7984 CIMMYT   Mexico 1 AY244508_26-5B A View all "AY244508_26-5B" genotypes
W7984 CIMMYT   Mexico 1 AY244508_270-5A T View all "AY244508_270-5A" genotypes
W7984 CIMMYT   Mexico 1 AY244508_270-5A GGTCAACTTGTCATGAAGCC View all "AY244508_270-5A" genotypes
W7984 CIMMYT   Mexico 1 AY244508_309-5A GGTCAACTTGTCATGAAGCC View all "AY244508_309-5A" genotypes
W7984 CIMMYT   Mexico 1 AY244508_309-5A C View all "AY244508_309-5A" genotypes
W7984 CIMMYT   Mexico 1 AY244508_316-5A G View all "AY244508_316-5A" genotypes
W7984 CIMMYT   Mexico 1 AY244508_316-5A GGTCAACTTGTCATGAAGCC View all "AY244508_316-5A" genotypes
W7984 CIMMYT   Mexico 1 AY244508_357-5A C View all "AY244508_357-5A" genotypes
W7984 CIMMYT   Mexico 1 AY244508_357-5A GGTCAACTTGTCATGAAGCC View all "AY244508_357-5A" genotypes
W7984 CIMMYT   Mexico 1 AY244508_433-5B G View all "AY244508_433-5B" genotypes
W7984 CIMMYT   Mexico 1 AY244508_433-5B --------------AGGCTG View all "AY244508_433-5B" genotypes
W7984 CIMMYT   Mexico 1 AY244508_759-5B T View all "AY244508_759-5B" genotypes
W7984 CIMMYT   Mexico 1 AY244508_759-5B --------------AGGCTG View all "AY244508_759-5B" genotypes
W7984 CIMMYT   Mexico 1 AY672996_279-5B -------------------- View all "AY672996_279-5B" genotypes
W7984 CIMMYT   Mexico 1 AY672996_279-5B G View all "AY672996_279-5B" genotypes
W7984 CIMMYT   Mexico 1 AY672996_313-5D C View all "AY672996_313-5D" genotypes
W7984 CIMMYT   Mexico 1 AY672996_313-5D -------------------- View all "AY672996_313-5D" genotypes
W7984 CIMMYT   Mexico 1 AY672996_731-5D T View all "AY672996_731-5D" genotypes
W7984 CIMMYT   Mexico 1 AY672996_731-5D -------------------- View all "AY672996_731-5D" genotypes
W7984 CIMMYT   Mexico 1 AY672996_91-5D C View all "AY672996_91-5D" genotypes
W7984 CIMMYT   Mexico 1 AY672996_91-5D -------------------- View all "AY672996_91-5D" genotypes
W7984 CIMMYT   Mexico 1 BE352570_342-7D G View all "BE352570_342-7D" genotypes
W7984 CIMMYT   Mexico 1 BE352570_342-7D -------------------- View all "BE352570_342-7D" genotypes
W7984 CIMMYT   Mexico 1 BE352570_55-7A A View all "BE352570_55-7A" genotypes
W7984 CIMMYT   Mexico 1 BE352570_55-7A -------------------- View all "BE352570_55-7A" genotypes
[ Download ]