grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "CIMMYT" from the experiment "Haplotype polymorphism in polyploid wheats and their diploid ancestors".

E.g., Germplasm PI 350731, Marker/locus BE496863_82-7B.

Items 1 to 25 of 5,072.       of 203 | Next

[ Download ]

Accession Name


& subtaxa

Country of


View All Genotypes on
CIMMYT 62056_4 CIMMYT   Mexico 1 BQ169448_470-6D G View all "BQ169448_470-6D" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 BQ169448_470-6D -------------------- View all "BQ169448_470-6D" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 BQ169448_512-6A -------------------- View all "BQ169448_512-6A" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 BQ169448_200-6A T View all "BQ169448_200-6A" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 BQ169448_200-6A -------------------- View all "BQ169448_200-6A" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 BQ169448_512-6A C View all "BQ169448_512-6A" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 BQ169448_520-6A -------------------- View all "BQ169448_520-6A" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 BQ169448_520-6A C View all "BQ169448_520-6A" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 BQ169448_161-6A T View all "BQ169448_161-6A" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 BQ169448_161-6A -------------------- View all "BQ169448_161-6A" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 BQ169448_210-6A -------------------- View all "BQ169448_210-6A" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 BQ169448_210-6A C View all "BQ169448_210-6A" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 BQ169448_442-6A C View all "BQ169448_442-6A" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 BQ169448_442-6A -------------------- View all "BQ169448_442-6A" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 BQ169448_191-6A -------------------- View all "BQ169448_191-6A" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 BQ169448_191-6A G View all "BQ169448_191-6A" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 BQ169448_34-6A -------------------- View all "BQ169448_34-6A" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 BQ169448_163-6A -------------------- View all "BQ169448_163-6A" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 BQ169448_34-6A T View all "BQ169448_34-6A" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 BQ169448_163-6A A View all "BQ169448_163-6A" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 BG274508_199-6D G View all "BG274508_199-6D" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 BG274508_199-6D -------------------- View all "BG274508_199-6D" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 BE607043_163-6A -------------------- View all "BE607043_163-6A" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 BE606541_251-6D GTAAGCCTCCGTCCCGCCCC View all "BE606541_251-6D" genotypes
CIMMYT 62056_4 CIMMYT   Mexico 1 BE607043_163-6A A View all "BE607043_163-6A" genotypes
[ Download ]