grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for marker "LDregion2F" from the experiment "Hamblin et al. (2005) Equilibrium Processes Cannot Explain High Levels of Short- and Medium-Range Linkage Disequilibrium in the Domesticated Grass Sorghum bicolor. Genetics 171: 1247-1256.".

E.g., Germplasm L-WA58, Marker/locus pSB0080.

Items 1 to 25 of 37.       of 2 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Germplasm
AusTRCF302660   NULL South Africa   LDregion2F GCAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAATTCGATCTT
CATACCAAACTCAACCAAATTGTCACTGCA-TTTAACACATTTGATTAGA
TTGCAACACAGAAATACCAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACAGAAAATGTGGAAAGATTGCTAGTTTTAGTGTTCGT
AGCAGAGTAAGCTACTA--------TGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGCGTTAGGCAGTTACAGTTTTGTTACAAACCCT
AAATCCATCTATAGAAATAATTAAACCCACAGTTATAAGTGTTGCAGACA
CCATCATACTGTTACTGTGAAGAACAAAT------ATAAGTAAAGTTGAA
GGCTTCTAATTTCAACATGAACATGAAATTAATC---GTCAATGATATGA
TGACACCGGAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGCGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGAGGGGTGAGTTTTTTGAGCCATTA
TCCACAGTTCCATCTGCAGTATATACGAATGAACTTGACAGTTGATGTGA
TATATCATTCTGTCTGTCTTCAGTGTTTGTCATAAAGCCAGAAGATTCTA
TGTGAACAGGATTTGTTCCCC, GCAGTATTACTAAAGCATGCAGCAGAA
CCACTTTCATCTAATTCGATCTTCTTACCAAACTCAACCAAATTGTCACT
GCA-TTTAACACATTTGATTAGATTGCAACACAGAAATACCAAATTGGGC
AGTGAACTTAAGAACAAATAAATATTTGATTCGATACAGAAAATGTGGAA
AGATTGCTAGTTTTAGTGTTCGTAGCAGAGTAAGCTACTA--------TG
ACCCATCTGACTGAAAATAGTGAATGCCATTACCAAAGAAGCGTTAGGCA
GTTACAGTTTTGTTACAAACCCTAAATCCATCTATAGAAATAATTAAACC
CACAGTTATAAGTGTTGCAGACACCATCATACTGTTACTGTGAAGAACAA
AT------ATAAGTAAAGTTGAAGGCTTCTAATTTCAACATGAACATGAA
ATTAATC---GTCAATGATATGATGACACCGGAGCACCTCAATTTACCTT
TGCTCAAACATTCCACATGTTTGCGAAAAGGAATCAGTTGATACACCAAA
TGAATTTAGAAGCGAATCAATTTCCATTTGCTCTTCACATTCATACAAGA
GGGGTGACTTTTTTGAGCCATTATCCACTGTTCCATCTGCAGTATATACG
AATGAACTTGACACTTGATGTGATATATCGTTCTGTCTGTCTTCAGTGTT
TGTCATAAAGCCAGAAGATTCTATGTGAACAGGATTTGTTCCCC
View all "AusTRCF302660" genotypes
AusTRCF302661   NULL South Africa   LDregion2F GCAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAATTCGATCTT
CATACCAAACTCAACCAAATTGTCACTGCA-TTTAACACATTTGATTAGA
TTGCAACACAGAAATACCAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATGCAGAAAATGTGGAAAGATTGCTAGTTTTAGTGTTCGT
AGCAGAGTAAGCTACTA--------TGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGCGTTAGGCAGTTACAGTTTTGTTACAAACCCT
AAATCCATCTATAGAAATAATTAAACCCACAGTCATAAGTGTTGCAGACA
CCATCATACTGTTACTGTGAAGAACAAAT------ATAAGTAAAGTTGAA
GGCTTCTAATTT---CA-GAAAATGAAATTAATC---ATCAATGATATGA
TGACACCGGAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
TGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGCGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGAGGGGTGACTTTTTTGAGCCATTA
TCCATTGTTCCATCTGCAGTATATACGAACGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTTCAGTGTTTGTCATAAAGCCAGAAGATTCTA
TGCGAACAGGATTTGTTCCCC, GCAGTATTACTAAAGCATGCAGCAGAA
CCACTTTCATCTAATTCGATCTTCATACCAAACTCAACCAAATTGTCACT
GCA-TTTAACACATTTGATTAGATTGCAACACAGAAATACCAAATTGGGC
AGTGAACTTAAGAACAAATAAATATTTGATTCGATGCAGAAAATGTGGAA
AGATTGCTAGTTTTAGTGTTCGTAGCAGAGTAAGCTACTA--------TG
ACCCATCTGACTGAAAATAGTGAATGCCATTACCAAAGAAGCGTTAGGCA
GTTACAGTTTTGTTACAAACCCTAAATCCATCTATAGAAATAATTAAACC
CACAGTTATAAGTGTTGCAGACACCATCATACTGTTACTGTGAAGAACAA
AT------ATAAGTAAAGTTGAAGGCTTCTAATTT---CA-GAAAATGAA
ATTAATC---ATCAATGATATGATGACACCGGAGCACCTCAATTTACCTT
TGCTCAAACATTCCACATGTTTGTGAAAAGGAATCAGTTGATACACCAAA
TGAATTTAGAAGCGAATCAATTTCCATTTGCTCTTCACATTCATACAAGA
GGGGTGACTTTTTTGAGCCATTATCCATTGTTCCATCTGCAGTATATACG
AACGAACTTGACAGTTGATGTGATATATCGTTCTGTCTGTCTTCAGTGTT
TGTCATAAAGCCAGAAGATTCTATGCGAACAGGATTTGTTCCCC
View all "AusTRCF302661" genotypes
AusTRCF302605   NULL South Africa   LDregion2F GCAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAATTCGATCTT
CATACCAAACTCAACCAAATTGTCACTGCATTTAACACATTTGATTAGAT
TGCAACACAGAAATACCAAATTGGGCAGTGAACTTAAGAGCAAATAAATA
TTTGATTCGATACAGAAAATGTGGAAAGATTGCTAGTTTTAGTGTTCGTA
GCAGAGTAAGCTACTATGACCCATCTGACTGAAAATAGTGAATGCCATTA
CCAAAGAAGCGTTAGGCAGTTACAGTTTTGTTACAAACCCTAAATGCATC
TATAGAAATAATTAAACCCACAGTTATAAGTGTTGCAGACACCATCATAC
TGTTACTGTGAAGAACAAATATAAGTAAAGTTGAAGGCTTCTAATTTCAA
CATGAAAATGAAATTAATCATCAATGATATGATGACACCGGAGCACCTCA
ATTTACCTTTGCTCAAACATTCCACATGTTTGCGAAAAGGAATCAGTTGA
TACACCAAATGAATTTAGAAGCGAATCAATTTCCATTTGCTCTTCACATT
CATACAAGAGGGGTGACTTTTTTGAGCCATTATCCACAGTTCCATCTGCA
GTATATACGAATGAACTTGACAGTTGATGTGATATATCATTCTGTCTGTC
TTCAGTGTTTGTCATAAAGCCAGAAGATTCTATGTGAACAGGATTTGTTC
CCC
View all "AusTRCF302605" genotypes
AusTRCF302577   NULL South Africa   LDregion2F GCAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAATTCGATCTT
CATACCAAACTCAACCAAATTGTCACTGCATTTAACACATTTGATTAGAT
TGCAACACAGAAATACCAAATTGGGCAGTGAACTTMAGAACAAATAAATA
TTTGATTCGATACAGAAAATGTGGAAAKATTGCTAGTTTTAGTGTTCGTA
GCAGAGTAAGCTACTATGACCCATCTGACTGAAAATAGTGAATGCCATTA
CCAAAGAAGCGTTAGGCAGTTACAGTTTTGTTACAAACCCTAAATCCATC
TATAGAAATAATTAAACCCACAGTTATAAGTGTTGCAGACACCATCATAC
TGTTACTGTGAAGAACAAATATAAGTAAAGTTGAAGGCTTCTAATTTCAA
CATGAACATGAAATTAATCATCAAYGATATGATGACACCGGAGCACCTCA
ATTTACCTTTGCTCAAACATTCCACATGTTTGCGAAAAKGAATCAGTTGA
TACACCAAATGAATTTAGAAGCGAATCAATTTCCATTTGCTCTTCACATT
CATACAAGAGGGGTGACTTTTTTGAGCCATTATCCACTGTTCCATCTGCA
GTATATACGAATGAACTTGACAGTTGATGTGATATATCGTTCTGTCTGTC
TTCAGTGTTTGTCATAAAGCCAGAAGATTCTATGTGAACAGGATTTGTTC
CCC
View all "AusTRCF302577" genotypes
Purdue No. 49506   bicolor, NULL Cameroon   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTCA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "Purdue No. 49506" genotypes
65I 1633   bicolor, NULL Chad   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTCA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "65I 1633" genotypes
L-WA12   drummondii, NULL South Africa   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "L-WA12" genotypes
L-WA42   arundinaceum, NULL South Africa   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "L-WA42" genotypes
L-WA55   arundinaceum, NULL South Africa   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "L-WA55" genotypes
L-WA88   arundinaceum, NULL Egypt   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "L-WA88" genotypes
65I 1502   bicolor, NULL Nigeria   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "65I 1502" genotypes
65I 1793   bicolor, NULL Mali   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "65I 1793" genotypes
65I 2133   bicolor, NULL India   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "65I 2133" genotypes
65I 2165   bicolor, NULL South Africa   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "65I 2165" genotypes
65I 2604   bicolor, NULL India   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "65I 2604" genotypes
66I 4680   bicolor, NULL Uganda   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "66I 4680" genotypes
74I 10917   bicolor, NULL India   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "74I 10917" genotypes
PI213900   bicolor, NULL Kenya   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "PI213900" genotypes
PI221540   bicolor, NULL Nigeria   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "PI221540" genotypes
PI221607   bicolor, NULL Nigeria   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "PI221607" genotypes
PI267523   bicolor, NULL Egypt   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "PI267523" genotypes
PI267525   bicolor, NULL Egypt   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "PI267525" genotypes
PI287624   bicolor, NULL Zimbabwe   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "PI287624" genotypes
PI510906   bicolor, NULL Botswana   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "PI510906" genotypes
PI510985   bicolor, NULL Botswana   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "PI510985" genotypes
[ Download ]