grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for marker "LDregion2F" from the experiment "Hamblin et al. (2005) Equilibrium Processes Cannot Explain High Levels of Short- and Medium-Range Linkage Disequilibrium in the Domesticated Grass Sorghum bicolor. Genetics 171: 1247-1256.".

E.g., Germplasm L-WA58, Marker/locus pSB0080.

Items 26 to 37 of 37.       Previous | of 2

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Germplasm
AusTRCF302577   NULL South Africa   LDregion2F GCAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAATTCGATCTT
CATACCAAACTCAACCAAATTGTCACTGCATTTAACACATTTGATTAGAT
TGCAACACAGAAATACCAAATTGGGCAGTGAACTTMAGAACAAATAAATA
TTTGATTCGATACAGAAAATGTGGAAAKATTGCTAGTTTTAGTGTTCGTA
GCAGAGTAAGCTACTATGACCCATCTGACTGAAAATAGTGAATGCCATTA
CCAAAGAAGCGTTAGGCAGTTACAGTTTTGTTACAAACCCTAAATCCATC
TATAGAAATAATTAAACCCACAGTTATAAGTGTTGCAGACACCATCATAC
TGTTACTGTGAAGAACAAATATAAGTAAAGTTGAAGGCTTCTAATTTCAA
CATGAACATGAAATTAATCATCAAYGATATGATGACACCGGAGCACCTCA
ATTTACCTTTGCTCAAACATTCCACATGTTTGCGAAAAKGAATCAGTTGA
TACACCAAATGAATTTAGAAGCGAATCAATTTCCATTTGCTCTTCACATT
CATACAAGAGGGGTGACTTTTTTGAGCCATTATCCACTGTTCCATCTGCA
GTATATACGAATGAACTTGACAGTTGATGTGATATATCGTTCTGTCTGTC
TTCAGTGTTTGTCATAAAGCCAGAAGATTCTATGTGAACAGGATTTGTTC
CCC
View all "AusTRCF302577" genotypes
AusTRCF302661   NULL South Africa   LDregion2F GCAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAATTCGATCTT
CATACCAAACTCAACCAAATTGTCACTGCA-TTTAACACATTTGATTAGA
TTGCAACACAGAAATACCAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATGCAGAAAATGTGGAAAGATTGCTAGTTTTAGTGTTCGT
AGCAGAGTAAGCTACTA--------TGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGCGTTAGGCAGTTACAGTTTTGTTACAAACCCT
AAATCCATCTATAGAAATAATTAAACCCACAGTCATAAGTGTTGCAGACA
CCATCATACTGTTACTGTGAAGAACAAAT------ATAAGTAAAGTTGAA
GGCTTCTAATTT---CA-GAAAATGAAATTAATC---ATCAATGATATGA
TGACACCGGAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
TGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGCGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGAGGGGTGACTTTTTTGAGCCATTA
TCCATTGTTCCATCTGCAGTATATACGAACGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTTCAGTGTTTGTCATAAAGCCAGAAGATTCTA
TGCGAACAGGATTTGTTCCCC, GCAGTATTACTAAAGCATGCAGCAGAA
CCACTTTCATCTAATTCGATCTTCATACCAAACTCAACCAAATTGTCACT
GCA-TTTAACACATTTGATTAGATTGCAACACAGAAATACCAAATTGGGC
AGTGAACTTAAGAACAAATAAATATTTGATTCGATGCAGAAAATGTGGAA
AGATTGCTAGTTTTAGTGTTCGTAGCAGAGTAAGCTACTA--------TG
ACCCATCTGACTGAAAATAGTGAATGCCATTACCAAAGAAGCGTTAGGCA
GTTACAGTTTTGTTACAAACCCTAAATCCATCTATAGAAATAATTAAACC
CACAGTTATAAGTGTTGCAGACACCATCATACTGTTACTGTGAAGAACAA
AT------ATAAGTAAAGTTGAAGGCTTCTAATTT---CA-GAAAATGAA
ATTAATC---ATCAATGATATGATGACACCGGAGCACCTCAATTTACCTT
TGCTCAAACATTCCACATGTTTGTGAAAAGGAATCAGTTGATACACCAAA
TGAATTTAGAAGCGAATCAATTTCCATTTGCTCTTCACATTCATACAAGA
GGGGTGACTTTTTTGAGCCATTATCCATTGTTCCATCTGCAGTATATACG
AACGAACTTGACAGTTGATGTGATATATCGTTCTGTCTGTCTTCAGTGTT
TGTCATAAAGCCAGAAGATTCTATGCGAACAGGATTTGTTCCCC
View all "AusTRCF302661" genotypes
AusTRCF302605   NULL South Africa   LDregion2F GCAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAATTCGATCTT
CATACCAAACTCAACCAAATTGTCACTGCATTTAACACATTTGATTAGAT
TGCAACACAGAAATACCAAATTGGGCAGTGAACTTAAGAGCAAATAAATA
TTTGATTCGATACAGAAAATGTGGAAAGATTGCTAGTTTTAGTGTTCGTA
GCAGAGTAAGCTACTATGACCCATCTGACTGAAAATAGTGAATGCCATTA
CCAAAGAAGCGTTAGGCAGTTACAGTTTTGTTACAAACCCTAAATGCATC
TATAGAAATAATTAAACCCACAGTTATAAGTGTTGCAGACACCATCATAC
TGTTACTGTGAAGAACAAATATAAGTAAAGTTGAAGGCTTCTAATTTCAA
CATGAAAATGAAATTAATCATCAATGATATGATGACACCGGAGCACCTCA
ATTTACCTTTGCTCAAACATTCCACATGTTTGCGAAAAGGAATCAGTTGA
TACACCAAATGAATTTAGAAGCGAATCAATTTCCATTTGCTCTTCACATT
CATACAAGAGGGGTGACTTTTTTGAGCCATTATCCACAGTTCCATCTGCA
GTATATACGAATGAACTTGACAGTTGATGTGATATATCATTCTGTCTGTC
TTCAGTGTTTGTCATAAAGCCAGAAGATTCTATGTGAACAGGATTTGTTC
CCC
View all "AusTRCF302605" genotypes
AusTRCF302660   NULL South Africa   LDregion2F GCAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAATTCGATCTT
CATACCAAACTCAACCAAATTGTCACTGCA-TTTAACACATTTGATTAGA
TTGCAACACAGAAATACCAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACAGAAAATGTGGAAAGATTGCTAGTTTTAGTGTTCGT
AGCAGAGTAAGCTACTA--------TGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGCGTTAGGCAGTTACAGTTTTGTTACAAACCCT
AAATCCATCTATAGAAATAATTAAACCCACAGTTATAAGTGTTGCAGACA
CCATCATACTGTTACTGTGAAGAACAAAT------ATAAGTAAAGTTGAA
GGCTTCTAATTTCAACATGAACATGAAATTAATC---GTCAATGATATGA
TGACACCGGAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGCGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGAGGGGTGAGTTTTTTGAGCCATTA
TCCACAGTTCCATCTGCAGTATATACGAATGAACTTGACAGTTGATGTGA
TATATCATTCTGTCTGTCTTCAGTGTTTGTCATAAAGCCAGAAGATTCTA
TGTGAACAGGATTTGTTCCCC, GCAGTATTACTAAAGCATGCAGCAGAA
CCACTTTCATCTAATTCGATCTTCTTACCAAACTCAACCAAATTGTCACT
GCA-TTTAACACATTTGATTAGATTGCAACACAGAAATACCAAATTGGGC
AGTGAACTTAAGAACAAATAAATATTTGATTCGATACAGAAAATGTGGAA
AGATTGCTAGTTTTAGTGTTCGTAGCAGAGTAAGCTACTA--------TG
ACCCATCTGACTGAAAATAGTGAATGCCATTACCAAAGAAGCGTTAGGCA
GTTACAGTTTTGTTACAAACCCTAAATCCATCTATAGAAATAATTAAACC
CACAGTTATAAGTGTTGCAGACACCATCATACTGTTACTGTGAAGAACAA
AT------ATAAGTAAAGTTGAAGGCTTCTAATTTCAACATGAACATGAA
ATTAATC---GTCAATGATATGATGACACCGGAGCACCTCAATTTACCTT
TGCTCAAACATTCCACATGTTTGCGAAAAGGAATCAGTTGATACACCAAA
TGAATTTAGAAGCGAATCAATTTCCATTTGCTCTTCACATTCATACAAGA
GGGGTGACTTTTTTGAGCCATTATCCACTGTTCCATCTGCAGTATATACG
AATGAACTTGACACTTGATGTGATATATCGTTCTGTCTGTCTTCAGTGTT
TGTCATAAAGCCAGAAGATTCTATGTGAACAGGATTTGTTCCCC
View all "AusTRCF302660" genotypes
65I 1633   bicolor, NULL Chad   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTCA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "65I 1633" genotypes
69I 7471   bicolor, NULL Uganda   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "69I 7471" genotypes
PI152702   bicolor, NULL Sudan   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "PI152702" genotypes
PI22913   bicolor, NULL China   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "PI22913" genotypes
PI257595   bicolor, NULL Ethiopia   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "PI257595" genotypes
RTx430   bicolor, NULL     LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "RTx430" genotypes
BTx623   bicolor, NULL     LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "BTx623" genotypes
KFS1   NULL South Africa   LDregion2F GTAGTATTACTAAAGCATGCAGCAGAACCACTTTCATCTAACTCGATCTT
CATACCAAACTCAACCAAATTGTCGCTGCATTTTAACACATTTGATTAGA
TCGCAACACAGAAATAATAAATTGGGCAGTGAACTTAAGAACAAATAAAT
ATTTGATTCGATACACAAAATGTGGACAATTTGCTAGTTTTAGTGTTAAT
AGCAGAGTAAGCTACTAGCCTACTATGACCCATCTGACTGAAAATAGTGA
ATGCCATTACCAAAGAAGTGTTTGGCAGTTACATTTTTGTTACAAACCAA
AAATACATCTAAAGAAATAGTTAAGCCCACA-TTATAAGTGTTGCAGACA
CCATCATGCTGTTACTGTGAAGAACAACT------ATTAGTAAAGTTGCA
GGCTCCTAATTTCAACATAAAAATGAAATGAAGAATCATCAATGATATGA
TGACACTGCAGCACCTCAATTTACCTTTGCTCAAACATTCCACATGTTTG
CGAAAAGGAATCAGTTGATACACCAAATGAATTTAGAAGTGAATCAATTT
CCATTTGCTCTTCACATTCATACAAGATGGGTGACTTTTTTGAGCCATTA
TCCACAATTCCATCTGGAGTATGTATGAATGAACTTGACAGTTGATGTGA
TATATCGTTCTGTCTGTCTCCAGTGCTTGGCATAAAGCCAGAAGATTCTA
TGTGACCAGGATTTGTTCCCC
View all "KFS1" genotypes
[ Download ]