grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "PI510906" from the experiment "Hamblin et al. (2005) Equilibrium Processes Cannot Explain High Levels of Short- and Medium-Range Linkage Disequilibrium in the Domesticated Grass Sorghum bicolor. Genetics 171: 1247-1256.".

E.g., Germplasm L-WA58, Marker/locus pSB0080.

Items 26 to 27 of 27.       Previous | of 2

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
PI510906   bicolor, NULL Botswana   LDregion6C CACCC-------AATCGCCTGAAAAATTGTGGCTGCCGTTTCAGATTGCT
CTCTGCATCTGATTTTTGGCTTTGCTTTACCTGCATGTCTCAAGTCTAGT
TACCATGGGAATACACATGTGTAACATGCTTTGCATATTTTCATTTTCAT
GGTCTTAGGCTCTTGTTTTGATGAATTAAATGCCTGCATTAATTCTTTCA
ATACTTTCTGCTAAGTTTGAGTTATCTTGTGCTTAATTGTATATTAGCTG
TATTAAAAGCACTGTGATACATAAAAATTTT--TTTAGTCACTTGAAAAT
ATTAAGAGAAATTTAGTTATCGGGGAGAAGGGGAGGGGATTGGGTTGGGT
TTTGATTCTCCCTTTTTAATTGTAGATATTATGCTAAGTCTTTTTTAGGA
ACAAAAGTTCAATTTCAGCTGGCTGACTACAATCAGCGGTGTGCTAATCT
TCTTTTACTGGAATGAAAGCACACATGCAGTTCAGCCTAACCTATTT-AT
CTAGGTGGGCATAAGAGTTTCATTGCTATTCATGTTAGTTTTTAAAAGTG
TGATGAGTGCAATATGGTGAATTGAGATAGCATCGGGGAGCTGAGCCATG
TATGTTACTGTGGTTTGACTTGTGGTGTGCTGTAGACTAATTTATT-GAC
ATGTGCTTCCATACCCATCTCTAAATTATTATGCTGTACTATCAGTTCAA
ACACATATGAGAATTAAACGTTTGTGGTTAAAACTGATCCATCCATTCTG
TAGTTGTTGTCTACCGCCTTTTAGAATTTAGAGTGACACCTTTCGACTAG
CATATATATCAGGGAGTTGGGAGAATGCCATAGTTAGAACTTAGAAGCTA
TTAGATGCAAGGGACATTTTGAATGTGAGACATTTATTTTATTGGCTAAA
CTTTGAATGAATGAAAATAATTATGATTTTAAGTATGGTTGTTCTAGTGC
TGCCAAGGATTAGGATACCTTAATTTGGGATACTAGGTTTGCTTATCCTC
TATAAATTACATTGTTTATTAGCAATGTGGCCTTAACACTTTCCATTCTG
ATGTTGCAGTCATCCTTTGGTTTCATTGACTACTATGACCGCAGATATGC
TGCACTAGCAATTTTATCTCTCAATGGCAGACCACTGTAAGCTTTTTGGT
TTTGTATTCCCTCCATTTTTAATTGTAAGTCGTTTTGGCTTTTCTAGATT
CATAGGTGTATAGCAAAACTATGTACCTAGAAAAGCCAAAATAACTTGCA
ATTGGAATGGAAGGAGTATGTGCTAATTTCTATGATCACTGCCCTGTTTT
TTGGCACTAATTTTCTAATTATCACCAAAAATCCAGGTATGGTCAGCCAA
TAAAAG
View all "LDregion6C" genotypes
PI510906   bicolor, NULL Botswana   LDregion6D ATGGTCTCATTACAGGGAAGATCTTTTGTCGGGTAAGCTCAGCTATTTGT
TTTGCATCTTTGTTAATTTAATTTAGGGGATTGATGCAATCTCTGGAGCC
AATATTTGCTTTATGGCTCCATAAGTTTGGACACAAGCAACTAGCAATTG
TTAAATTTGCAGAAAAGGGCAAAGTCACACCGTTACTCTGTGCTGCTGAG
TGCATGGTTATATTGATGTTAAGTTTTATAAAGTGTTTCAGTATCTTATG
AGCCCATTTTTCCATTTCAAAATCCTGGATATCTATCAATTTTGTCTTAT
AACAGTAATAATAATGT-GGGGCAATACGTTTTGTGGGCATATAATAGAG
GGTAAATGTTATCCCTCTAGGTTCAGCTTGGTCTCTAGAAATCAGGACAA
AACCAGGCATCATGG-CCCCCGATGCCAGGATGAAAACGGTA-TAATTTG
AACTTGAAGAAAACCGAAGAATTATTCATTTGGCTGATATTGATATGCCT
AGCTGCTGCTGTCTTAGGGATAACTATGTTTGCACTCTGGATATCAACAT
TGATTTTAAAATTTAATTTGCTTGATTTTGATACTGGAATGGAGATTTAC
GCACTTCAACTTGC--TATCTGTTGATTTTAAAGTCATGTCAACAATCAC
CTTAGAACATTGTTGCCGCATATGGGAGTATTGACAGTGATTGTTCGATC
TTAGGTTTGGCCACTGGAGGGCTTTGGTCCAATTGATTCAAACCAGTCTT
AACAGGGGTAATTTAGCTTCTTTGTTGCATCTTGTTTTCTAAAGGTAA
View all "LDregion6D" genotypes
[ Download ]