grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "Purdue No. 49018" from the experiment "Hamblin, Casa, et al. (2006) Challenges of Detecting Directional Selection After a Bottleneck: Lessons From Sorghum bicolor. Genetics 173: 953-964.".

E.g., Germplasm L-WA58, Marker/locus pSB0080.

Items 1 to 25 of 216.       of 9 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
Purdue No. 49018   bicolor, NULL Cameroon   lgf6 AAACAGTCGGAGGAGAAGAGGAGGATGGGCTTCGAGAAGCAGATCTTGAG
AGCCGGGACCGGCCCCAAGCCGGTAAAGGGCCAGAAGGTCACCGTCCACT
GCACCGGCTACGGTTCGCTCCTTCCCTTCATCCCATAGACCTCTGATTTA
CCACGTTGTTCTTGGATCCGCATCACTTCAGGGTTTAGAGTTAGATTCTT
TCAGATCCATGTCGTGTAGTAGCCTCGATGAATAAGCGGCGACCCTTTTT
TTCTCGGCTTTGATGCTTATTAGGATGCGATGTTCAGTCGTAGGGTTGAG
ATCGATCTGATCCAGAGTTGCAAGCGAACCTAGTGCACTGCATAATTCGT
TTCCTTTTCTTTTGTGTTATGACTATCACTATCTGATCTGCAGTAATTGT
TTGCTAACTTTTGCTTACTGCTATGGGTTTGTTTTCAGGGAAGGATCGTG
ATCTATCCAAGAAATTTTGGAGGTAAACTATCAATCTATTTTCTTGATTT
ACATCGAAGTGTAGCACATCAGTGGAATAAGCACGTGTACACTGAAAGTA
GTTCTTTTCCTGTCAGTCACTATGTTCTGTTGTTTCTTTCAGCACCAAGG
ACCCTGGGCAGCAGCCATTCAGTTTCAACATTGGTCTGGGTTCAGTGATC
AAAGGTAATCATGCCACATATCATCAGTTCATGTGAAGACCTTATAACTT
TGCCTGTTAGTTATCTTCACGTGTATTACTTTGTGATTTAGCAAGGGTTC
CATTACCTGATCATTCTGATTGCTTCCAGTCCGTATGTTATATTGGTATA
T
View all "lgf6" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgj6 AAAGCTAGTGCACGCCGCACCACAAAGCTTTACTACTTTGATTCAGGTTT
GGCTGCCAGGTGCAGAGCTGTAACATGAAGTACCCTCATTCCATTCGCAG
GTTTTTGGACCAACAGCAAAGCAGAAGGACTTGTATGACCAGGCCATCAT
TCCTATTGTAAATGAGGTCTTAGAGGGATTCAATTGCACCATTTTTGCGT
ATGGGCAGACAGGCACTGGGAAAACGTACACCATGGAAGGAGAGTGCAGG
AGAGCCAAGGCAAGTCTATGCTGTTTTTTATGACTGTATTATGCTTCTTG
GTTGTCTCAATTGCTGATTACTGCTAGTGCTCGAATGCTTGCAGAGTGGA
CCAAAGGGCCAATTACCTGCAGA
View all "lgj6" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgj6 AAAGCTAGTGCACGCCGCACCACAAAGCTTTACTACTTTGATTCAGGTTT
GGCTGCCAGGTGCAGAGCTGTAACATGAAGTACCCTCATTCTATTCGCAG
GTTTTTGGACCAACAGCAAAGCAGAAGGACTTGTATGACCAGGCCATCAT
TCCTATTGTAAATGAGGTCTTAGAGGGATTCAATTGCACCATTTTTGCGT
ATGGGCAGACAGGCACTGGGAAAACGTACACCATGGAAGGAGAGTGCAGG
AGAGCCAAGGCAAGTCTATGCTGTTTTTTATGACTGTATTATGCTTCTTG
GTTGTCTCAATTGCTGATTACTGCTAGTGCTCGAATGCTTGCAGAGTGGA
CCAAAGGGCCAATTACCTGCAGA
View all "lgj6" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgi4 AAAGTTTGCAGCATGGCAGAAGTTTCATAGCCAGATCAGTCAAGTAGAAG
CTCGAATTCAGAGGCTAGGCGAAATTAGGAATCGATATGGCATCTTGGCA
GGTGAAATAGACAGGAGTAACAAATTGAGGAAACCCAATCAGCTCTTTAT
GTCAGATTCTTCTTACTTAACTGATAGCTCTGAAATAGTGGGGTATGTTG
ATGAAATTGGAAGATTGACACAATGGTTACTTGAGGACAAACAAGAGCGA
ACTCTCATTGCCATCTTTGGTATGGGAGGTCTAGGAAAAACTACTATTGC
AAGCAGTGTGTACAAGAATCAGAATATCACAAGAACTTTCAACTGTCACG
CATGGGTTACTGTATCTCAGACTTATCAAGTTGAAGAACTACTAAGAGAA
ATCATAAATCAGCTAATTGATCAGAGAGCAAGCATGGCAAGTGGTTTCAT
GACCATGAACCACATGAGGCTAGTTGAGGTAATACAAAGCTATTTGCTAG
ACAAAAAATATTTAATTGTCTTGGATGATGTATGGGATAAAGATGCATGG
TTATTTCTAAACCATGCGTTTGTCAGAAACAACTGTGGAAGCAAAGTGCT
GATAACTACTCGGAGAAAGGATGTATCTTGTTTGGCAGTAGATCACTATA
GGATTGAACTTAAAACTCTTCAATATGCTGAATCCTGGGAGCTTTTCTGT
AAAAAGGCATTTGTTGCATTAAAAGATAGCCAATGTCCTGAAAACCTTAG
GTTTTTTGCAGAGAAAATTGTTGCCAGGTGTCA
View all "lgi4" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgj109 AAATATACCAATACGCGTGCAAGCGATTACTACTACCCCCAACAAGTTAA
CACGTTCTCGGCCATTTGTGACGCACCTACGAGGTTGTAATTTTAGCTGT
TCGCACAACAGAGTGAGACAAAAAATCATTTTGTTGCGTGAGCTTTGCAG
GTGGCGAAGGAGCAGGCGGAAAGGAGGGAGACGGCGAAGCAAATGTTTGA
ATTGGGGCAAAGGGCCTACGGGAAAGGAATGTATGGACGCTCAATTGAAT
TCTTGGAGGCTGCACTCACTATCATACGTCCCTCCTCTCTCCTCGGTGGC
GAGGTAATATCTCTGTAGTTGAGAATTTGAGAAAGGATGAAAACGGTCGG
AAATGGTCGAAAACGGAATTACAATGTAGAAAACGAAAGCGGTCGGTACG
GAATATTTCTATATTTTAGCAATTAAAGAGTACAAAAAAAGAATAAAAAT
GGTTGTGAAACCAACTGAAACTGACAAAATTTTATGTTTGACAAAATTCG
AAAACAGTTTCATAATATAGAAAACGATATCATAATGTAGAAAACGAAAG
CGGTCGGTACGGAATATTTCCGTTCCGTTTTCATCCTGGATTGAGATTTC
TGTAGCTTTCTCATCTCTGGCTGTATGCCAATTAACTCTTTTCGAGTTTG
TTGGAACTTGGAAGGGAAAACCTATGGCTAAGATTCTGTACGCATCTTTG
TGATATAGTG
View all "lgj109" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgj109 AAATATACCAATACGCGTGCAAGCGATTACTACTACCCCCAACAAGTTAA
CACGTTCTCGGCCATTTGTGACGCACCTACGAGGTTGTAATTTTAGCTGT
TCGCACAACAGAGTGAGACAAAAAATCATTTTGTTGCGTGAGCTTTGCAG
GTGGCGAAGGAGCAGGCGGAAAGGAGGGAGACGGCGAAGCAAATGTTTGA
ATTGGGGCAAAGGGCCTACGGGAAAGGAATGTATGGACGCTCAATTGAAT
TCTTGGAGGCTGCACTCACTATCATACGTCCCTCCTCTCTCCTCGGTGGC
GAGGTAATATCTCTGTAGTTGAGAATTTGAGAAAGGATGAAAACGGTTGG
AAATGGTCGAAAACGGAATTACAATGTAGAAAACGAAAGCGGTCGGTACG
GAATATTTCTATATTTTAGCAATTAAAGAGTACAAAAAAAGAATAAAAAT
GGTTGTGAAACCAACTGAAACTGACAAAATTTTATGTTTGACAAAATTCG
AAAACAGTTTCATAATATAGAAAACGATATCATAATGTAGAAAACGAAAG
CGGTCGGTACGGAATATTTCCGTTCCGTTTTCATCCTGGATTGAGATTTC
TGTAGCTTTCTCATCTCTGGCTGTATGCCAATTAACTCTTTTCGAGTTTG
TTGGAACTTGGAAGGGAAAACCTATGGCTAAGATTCTGTACGCATCTTTG
TGATATAGTG
View all "lgj109" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgf102 AAATTTGTCCGGTTCTCATGCCAGTTTAAGAAATTATTGTTCCGTTCTTT
TAGTTATTTATAAATGAATTTTTGCACTATTAATTCTTTCTCATTCCTTC
AGACCAAAATTTCTCCTGCGTTTGTGCTATTCTTTGACTGTTCTGAGGAA
GAGATGGAGAGACGTCTCTTGGGCCGCAATCAGGTTTCCTTCATCGTTGA
CCAATTGTGTTTTTTAATCATGAAATTCTTGTTTCCAATATTTCTTACTG
TCTTTGCAGGGAAGAGTTGATGATAACATTGAAACTATCAAAAAAAGGTT
TAAAACCTTTGTTGAATCAAGTCTGCCTGTCATTGAGCATTACAACTCAA
GGGACAAGGTTAAAAAGGTATTGATGAACTTTTATCTTTCCAGGGGTACT
CCTATTGCACTCCGATCCGATGATGCAAATATGTGATGTATTATACCGTA
GAAATAAAGCCAGAGTAAGATGCACATTAGAATAAATAAGTGAGGTTAGA
AGGATATTTTAGATCTATCGTGTGTGTATTCC------------------
AGTCCACATTTCAATTAGTTGATGGCCTTTTCTTTTGCAATGTTTTCACT
TTAGCCCCCTATAGTAACTTTTCATTTTATCAGATTGATGCTGCAAAACC
AATTCCTGAGGTGTTTGAAGACGTCAAAGCCATTTTTGCCCCATATTCTT
CAAAGGTAATTAGGTTTCACTTGTTCTTTGTGTATTCTTTTGC
View all "lgf102" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgf102 AAATTTGTCCGGTTCTCATGCCAGTTTAAGAAATTATTGTTCCGTTCTTT
TAGTTATTTATAAATGAATTTTTGCACTATTAATTCTTTCTCATTCCTTC
AGACCAAAATTTCTCCTGCGTTTGTGCTATTCTTTGACTGTTCTGAGGAA
GAGATGGAGAGACGTCTCTTGGGCCGCAATCAGGTTTCCTTCATCGTTGA
CCAATTGTGTTTTTTAATCATGAAATTCTTGTTTCCAATATTTCTTACTG
TCTTTGCAGGGAAGAGTTGATGATAACATTGAAACTATCAAAAAAAGGTT
TAAAACCTTTGTTGAATCAAGTCTGCCTGTCATTGAGCATTACAACTCAA
GGGACAAGGTTAAAAAGGTATTGATGAACTTTTATCTTTCCAGGGGTACT
CCTATTGCACTCCGATCCGATGATGCAAATATGTGATGTATTATACCGTA
GAAATAAAGCCAGAGTAAGATGCACATTAGAATAAATAAGTGAGGTTAGA
AGGATATTTTAGATCTATCGTGTGTGTATTCC------------------
AGTCCACATTTCAATTAGTTGATGGCCTTTTCTTTTGCAATGTTTTCACT
TTAGCCCCCTATAGTAACTTTTCATTTTATCAGATTGATGCTGCAAAACC
AATTCCTGAGGTGTTTGAAGACGTCAAAGCCATTTTTGCCCCATTTTCTT
CAAAGGTAATTAGGTTTCACTTGTTCTTTGTGTATTCTTTTGC
View all "lgf102" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgc21 AACCAACCAAATTCACCTGTTCCGATTGTTTAATGCGACATGACAAGCTC
AAACGACTTGTTCCTGTTACCATTTGAAAAGGCTCGCCGGGATCTCAAAT
TTATTGTGGACAA----TAAATAAATAAATAAATAAACAAACAATCTAAT
TTCATTTCCAGATCTACTACTGTAAATATGATCAGACAAGCGGGCAGACG
CCGGTTGAGCTTGAGCCTCTGCCTATACTCCTGCTGAATAAACAACACAC
GCTACTGCAGGGCAACAATTACACATACAGCTACGAAACAGCCACTTTAC
ATCCAAATCCAATCCAATCACCACTGCAGGAT------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
---------------------GTACTAACTAACGTCTCAACTCGAGTCTC
GCAGTACCTATAAAAATGCCCAATGTCAGTCACTCGAAAATCTGGGCAGA
ATGGTTCAGCATCGCCCACTTT-----ATACTACTCTAGCACGAGCATCC
CTACTGGTGGTTTCAGTCTTCACGTTATCATCGGCATCCGCCTCAGGCTC
GCACTGCCCGCTTTCAGGGCCAGAGACCTCCCCTGGGCTCCGTTTCTGAC
TATCCTCCACCCCGCCGTTGTCAGAATCCATTGGTGCCGCCCCTTCTTCT
GGATCGCCACCACTGCCACCGCCATCGGTTTCTGGTGTCGCAGCAACCTG
CACAGAGCAG-CCATAGCAACAATGTAGACATGACATTGTTGGTGTTTAC
AGATGATGTTAAAATGACAA-TTATGATCAAGAAGACAGTCGA
View all "lgc21" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgd13 AACCTGGTTCTTACCGACCCAACGAAAGGGATGGGTGGAACAGTGAGAAA
AGCAGCAGAGCTTTATGAGAAACATCCTAGTGCATACATGCTTCAACAGT
TTCAGAATCCTGCTAATGTCAAGGTACTCTCCCTTTCTTGTTCTTCAACA
ATTTTGAATGATCTGGCCATGAGTTACACTTTGTAGGGGTAGTATTTAGT
ATACATTTGAAGCTGTTTCTTAAGGGTTACTGACTAAATCTCTGACAGGT
ACATTATGAGACAACGGGTCCAGAAATATGGGAGGACACACTTGGACAGG
TTGACATTTTTGTCATGGGCATCGGGAGTGGCGGTACTGTCACGGGAGTC
GGCAAGTACCTCAAGGAGAAGAACCCTAATGCAAAGGTACTATCATAGAC
CAGACAGAACAAAATCTCATAGCTAGATGCTCATAAGGTGTAGTTTCTGG
AAGTTGTATTCAGTTATGTTGTAAATCTCATAGCGTGTACATGGAAACTT
GCAGATATATGGAGTTGAACCTGCTGAAGCAAATGTTCTGAATGGTGGAA
AGCCAGGTGAGCTTTGGCATTCTTTAAAAGAACTACTTCCCCCACTGTGC
ATAGTTTTAATATCTTTCAATATTGTTTGCGGAATCTAATTGCAGGACCT
CACCTCATCACTGGAAATGGAGTAGGGTTTAAGCCAGACATTTTGGATAT
GGATGTAATGGAAAAGGTTCTTGAGGTAATGCTGAAACTATTTGTAGTCA
ATACCCTTTTAAAATC
View all "lgd13" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgb102 AAGCGCCACTTCACTTCGGACCTGACTACTTTGATAGTTTGATGAGTGCT
CAAGTAGGTCAATCTGTTTTTTGAGGCAAAGTAGGACAATCTGTTTTTTG
AGGCAAAGTAGGACAATCTGTTGTAATAGGAGCTGCTCTTCTTTTTCGGT
GTTAGGTGCTTGGTGCTAGGTGTTGGGTCGGTGGTAATCCTGGGATTACT
GTTGGCCGGTTGTGTACTTTAAACTCTACTTCCTCTCAATCTGTTGACAC
GGTCGCGAAAAAAGTAGGACAATCTGGACTTCCCTGTGCTTTGTAGTCCT
GCAGATTCTTAG--------------------------------------
--------------------------------------------------
TATTCTGAATATCTCAGTTTATTTAACCTTTGCAGCAGAAGATAGCAGTA
TGTTTGGTCCTAACTTAGATATACCCAATCTGAAAGCTTAAGTATTTTTT
GAAGAGAAGATGTCTGAAAACTTCAGTGACGACATGGGTTTCAGCTATAG
CAGTCTTACACGTCCTT---------------------------------
--------------------------------------------------
---AAAGACAGAGAAGATATTAATTCAATGTTTAGAAAGAATAGGTGCTA
TGGGCGCATCTTATCATTTATGTGGGGAGGGGAACATATATTGTGAAAAT
TGGAATATTCCCTTACTAATAAGTCTGTATGATTGTGACATATATGTAGT
AGTATATAAATACATCAAAGGGCAGCATGCATTTACATGTATTTAGCATG
CCAGCGCACTTCTGAAGAATGAAGTGTGATGAATGCTGAACAGATTGAGT
TCTGTTTCAGTTGTGATGAGT
View all "lgb102" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgd1 AAGGAAACAACTTCATAATGTAAACTTGATGTTGTTTCCTGGAACATCCT
TACTAACTAAGAGATTGGATGGATTTATTATGGCCACAAAACCAGGTTCA
CTACCTGCTTGCTTACCACTAGCCACATTTGTGCCTTGTGGTTTATGGTT
TTGGGCATACCATGACCTCCTTCCATTTGTTTGTGTGCCCATAATACTCA
TAATTTTGAAACTATGCAGGTGAGGCAAAGGATATACATGAAGTTTTTGG
AGTACCAAATGGTAAGTTTATGCCTAATGGGAAAGCAAGTGAGCACTTCG
AACTCCATGACCTTGACTTGTCCGGGACAGAGTTTAAAGCTGAGGTTTCC
ATGAGTGGTCCATTCAGAACACTGAAACATGAATGTGGTTCAGCAGCATG
GTTTCAGTCTACTAAGGTTTGGTACACCAGCTCTTGAGACTTTAAGCTCT
TTTTACACATAAAAGAAAAGGATTAATGTTTCCTATATAAAAAA--ATAT
ATATTCAGATGGTTGCACATAAATATCCATTTCCATTATACCGGTTTACT
TGTATACATTTGTGAGCTTTGCAGTTGCATGTAGTCCACGCAGGTATACA
GTCCATTTGCAATTTTAGTGATCTATGAGCTCAAATCTTACTAGTGCTAC
TTTGTTAGCCAGAAGCATGCTGTTCTTGTATCTCGTCCTC
View all "lgd1" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgd1 AAGGAAACAACTTCATAATGTAAACTTGATGTTGTTTCCTGGAACATCGT
TACTAACTAAGAGATTGGATGGATTTATTATGGCCACAAAACCAGGTTCA
CTACCTGCTTGCTTACCACTAGCCACATTTGTGCCTTGTGGTTTAGGGTT
TTGGGCATACCATGACCTCCTTCCATTTGTTTGTGTGCCCATAATACTCA
TAATTTTGAAACTATGCAGGTGAGGCAAAGGATATACATGAAGTTTTTGG
AGTACCAAATGGTAAGTTTATGCCTAATGGGAAAGCAAGTGAGCACTTCG
AACTCCATGACCTTGACTTGTCCGGGACAGAGTTTAAAGCTGAGGTTTCC
ATGAGTGGTCCATTCAGAACACTGAAACATGAATGTGGTTCAGCAGCATG
GTTTCAGTCTACTAAGGTTTGGTACACCAGCTCTTGAGACTTTAAGCTCT
TTTTACACATAAAAGAAAAGGATTAATGTTTCCTATATAAAAAA--ATAT
ATATTCAGATGGTTGCACATAAATATCCATTTCCATTATACCGGTTTACT
TGTATACATTTGTGAGCTTTGCAGTTGCATGTAGTCCACGCAGGTATACA
GTCCATTTGCAATTTTAGTGATCTATGAGCTCAAATCTTACTAGTGCTAC
TTTGTTAGCCAGAAGCATGCTGTTCTTGTATCTCGTCCTC
View all "lgd1" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgc111 AAGGTTTCAACTTGAACAATGCCAAGAAATAATTACGGCAGCAGTGGCAG
CTGGCTGGGTGAAGCTGAGCTGCGAAAACGCAGGCCGGGCCTCACTGCTG
TAGATCGGATTATTCGCGCCTATTCCTAGTTCATCCATGCATGCACGATC
AGTGAGATTAAACAAACGAAAAGATATCCTTTTCCATAGAAGCCGGCGTC
GTTAAACAATGAACACAACAAACAAAAAGTACCTAGGCAGTTCTCTGAAC
CGTGCATAGCAAAAAGCGTTTGTGTCTGAAGGCCGTGGAGTGGCGGCGAC
AAGTTCAGAGAGTCGAACCGGCCATACTCCGCTGCCAGTCTGCTCAGTGC
AAAACCAAATTCAGTTACTTGAAATGGCACACGATGAAAATGTCCAGCGA
TGGAACAGGAAGAACACCAACTCCCGGACGAAGCCAGTGCAGCGACATGG
AAGATAGAACTCACATCCTGTCCAGGCCCACGGATCCTGCCGATGAACTA
GAGCTCTCGCACCTGGCTGCACGCATCGAAGAAAAGCCACGATGACTAGA
CTGCATTCCATCCAGAGGGAAACGCGACCAAGAGGATTGCAGGACGGTAG
AAGAACCAAGAACGTACCGTAGTCGTCGCCGTACTGCAGCAGGAGCGAGT
GCGGTGCAGCAGAGTAGTTCCACATTGCGCACCGATGGAAATGGAACTCC
GATCGTCGGCAGCCCGCCAACACGTACGCAGGTCCTCTCACCGCCTGGAA
ACCAAACGCCATGCCCGTGGTGTTGAGGGAGGGAATAC
View all "lgc111" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgc20 AATACCAGAATCTGTAATGATGCATGACTTTGCCATCACGGAGAATTACT
CTATTTTTATGGACCTCCCTTTGTTGTTCCGACCAAAGGTGTGTGGTATT
GGTGCACAGAAAACCTTCTTTGCATTTTCTTTCTGTGCTACTTATTTACA
TTCAGCTGACAGATGTCCTAGTCGATTTCCATTTAATGCACTCGGGAAAT
GCTTCAAACCCGTTTTCATAACTAGATCCTTATTGTTTTTTTATTGTTTA
CAGGAAATGGTGAAGAACGGTGAGTTTATCTACAAGTTTGATCCTACAAA
GAAAGCTCGTTTTGGTATTCTCCCACGCTACGCAAAGGATGAAAAAGTCA
TCAGATGGTTTGAACTCCCTAATTGCTTCATATTCCATAATGGTATGGCG
CCTTTAGCTTTCTGCTGAATGTATGACCTTTTTAGATTTTTCTTGAACCT
CCTTTTTTTTTGGCAAACTTGTGCTTCTCCTTTAGAAGCTTCTGATAGAA
TTATGCGACAGTATAAAGAACAGAACTCAAGCTAGATCCGTTTCCAATTA
CTGTGCTTGACTATGCAATTCCATGTATTGCACTTTCTTAGTTTGAGCTG
ATCTTTGAGGACATGTATTGTCACAGCTAATGCTTGGGAAGAGGGTGATG
AAGTTGTTCTCATTACCTGCCGCCTTGAGAATCCAGATTTGGACAAGGTG
AATGGAC
View all "lgc20" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgf7 AATCTTTATTTAGCTACTATATGTTGCTTGCAAAAGCATTGTTTGATGCT
TGCCTTTCCTCCAACAAAATTGCATATATCCCAAGGCAAAACTGAAAACT
TAAGATTTTATTGCCTTTTGAAATGTGCCATTCAAGAACAGGATTGATGT
TTCAAATCTGCCTTGTGCAGATGTACGCAATGCTAGAACGAATTAGCCCA
AGGACAAGGAAGTTGGAACTGTTTGCAAGAATGCATAATACACAAGCTGG
GTGCGGACTAATCGTTGCCTCTCTTCTTGGCCAAGTTTTCTGTCTCATTC
TAACCAGATGCACACTATTATATTTCAACTTACATTTTTCTCCTGGGCAG
ATGGCTTTCACTGGGTAACCAATTACAAGGGGTAAGGCTTGTTGATGAAG
GGTTGAGAGCAAGGTACAAGGCTGCTTACCCCGATGTTGAGGTCCAGCCA
CTGTCTCCTCCCAGGACAAGCGCACCAATGGATGTTGACCAAAGTAGTTC
ACAGAAGGCTGCTGCGCCAGATGGTGGCGAGAGGCCCGCCTGATGCTTGC
AAACTTACTTGCAAGTCACCGTGTCAGGACCCACTACTGATCATATAGTT
TTCATCACTGTTAGCGTTACCCCTGTTGTAAAATTAGGCAGCTC
View all "lgf7" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgh105 AATGCTGCACAGAACTGACGGATTTCAGTAAGTAGCTAGCTAGAGAACGC
TCCAATTATTCCTCCAAACATTAGACAAATGCAATAAAAAAACTAGGATG
AATTTTGTCCGATCATTTATGTTTCTTTTTTGGCAGCTGCCTTGACAAAG
CAGCAGTAGACACCGGAAAGGCTGGTGCCTGGACTCTCTGCAGCGTAACC
CAGGTGGAGGAGACCAAGATCATCCTCCGGATGGTGCCCATCTTCCTCAG
TGCTGTGCTCGGGTACATTCCGGTGCCGCTGATCCTCAATTTCACCGTGC
AGCAGGGCAACACAATGGACACCAGGCTCGGCGCAGTTCACATCTCACCC
GCAACGCTATTCGTCATCCCTACGGTTTTCCAGATGGTTATCCTCGTCGT
TTACGACCGGTTCATTGTCCCGTTCCTAAGACGAATAACCGGCTATGTGG
GCGGTGTCACGCACCTCCAGCGCATCGGCATCGGGTTTCTTTCGACCATA
GTGGCCACTGGCATTGCAGCCCTAGTGGAGGCCAAGAGGAAGAAGGTGGC
AGAAGACAGTGGCCTTGTGGATGCTACAACTGGAATTCCAATGTCTGTTT
TCTGGCTGACCATACAATACTTCCTTCTAGGTGTTGTGGATGTCACCTCC
TTTGTAGGGCTTCTTGAGTTCTTCTACAGTGAGGCGTCCATGGGGATGAA
GTCCATTGGGAGCTCCATCTTCTACTGCATCCTTGGGGTGTCTGCTTGGC
TGGGGAGCCTGTTGATCCAATTGGCAAACCGCTT
View all "lgh105" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lga15 AATGTGCAATA-----ATATGCAGGGGCATGGCGGTTGCCGATGCATCGA
GCCCGTACAAGGTGAAGCTGCTGGTGGAGGACTACCCATACGCGTCGGAC
GGGCTGGCAATCTGGCACGCGATCGAGCAGTGGGTGACGGAGTACCTGGG
CATCTACTACCCCAACGACGGCGTGCTGCAGGCGGACGTGGAGCTGCAGG
CATGGTGGAAGGAGGTGCGCGAGGTCGGGCACGCCGACCTCAAGGACGAG
CCATGGTGGCCCAAGATGGAGACGGTGGCGGAGCTCGTCAAGGCCTGCAC
CACCATCATCTGGATCGCGTCGGCGCTCCACGCCGCCGTCAACTTCGGGC
AGTACCCGTACGCCGGGTACATTCCCAACCGTCCGTCGGTCAGCCGGAAG
CCGATGCCGGCGCCGGGCAGCGAGGAGTACGCGGAGCTGGGGAAGAACCC
GGAGAAGGTGTTCGTGCGCACCATCACGAGCCAGTTCCAGACACTCGTCG
GCATCTCGCTGCTGGAGATCCTGTCCAGCCACTCCTCCGACGAGGTGTAC
CTCGGCCAGCGCGACACGCCGGAGTGGACGTCGGACGCCAAGGCGCAGGA
GGCGTTCCGGCGGTTCGGGGCGCGGCTGACCGAGATCGAGAGCCGCGTGA
TGACCATGAACGCCGACCCAAGTCTCAAGAACCGCAACGGGCCGGCCAAG
TTCCCCTACACGCTGCTCTACCCCAACACCTCCGACAAGAATGGCGATGC
CGCCGGCATCACCGCCAAGGGCATTCCAAACAGCATCTCCATCTGAGTTC
TGAGTTCTGA
View all "lga15" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgh10 ACATTGGTTTCCTTTATCCTATGGTTAGTTGATACCCACCCATCTTGGTG
CAAACTAAAATTGAAGTGTATATTATCTGACAGGAGGAGCTGAGGTGGGA
TGAGATGCTGATCAGACACTACCAAGGGAGAGAGGTTTGAAAATTAGCCT
GCTGCTGTTCTTCCCACTTGTGATTCTGGTTGGTGGAGTGCATGTTTGCT
TATGCTATGCGGGGATGTATTGGTGCAGTCATTGTGGAACCATCGCCGGT
TCCTTTCACACTGGTGGATACAGCGCTTGCTCACTGTTGAAGAAACCTGC
CTCTCAACGATGTCCCAGGTGGATCTATTTGTGACCCAGGAGATAAACCT
GCTGTCAGAGTGCTTGAATGACCCTGAGGATGAGTTTGATGAGTCACGTG
TTCAAGCAGAGCTTTCAGCACTCTACATCCTCTGGATATCAAAGGCAACC
ACTACCCGTTTTACCCAGTTTGCTTAATTGCTTAGTGCTGGTAGTTTGCT
AGGATAGATTCTTTTGCTCTCAAGTGAAGGATTCAGTTTAGTTTTGACTG
GGAAACTATTCGTTGGATGCAGCAAGTCCCGGCATTGAAAGGGAAGCTGG
AAGAGAGGCTGCATCCCATTTCCATGGGGAGGCTGCAGGACGTGATGGAA
AGAGCCTG
View all "lgh10" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lga110 ACCATTTCTCAATCCGTCTTGAAGGGTCAGCCGCGTGGCTGCTCTCGTGT
TGGTGATCGCGACACGCGAACCGATGCCCCGGCTGTTCTACGCAGCCGAT
CATACTGCGCGGCGCCATCCAAGTCCGTCACAACTTGGTAGATCCGGGTG
CCTTGTTGCGTTCTTTCTTAATACATGTCGATGGTTGTTCGACTAGCTGA
TGAACTCCCACGTCCTTGTGTCCTCGAGCTGCTAATTTCTCTTGTGTTTT
AAAATAATGGAAATTACATCTGTGTTGTGGTTTCTGCAGATGGAGGAGGC
TATGCTGTCGATCTTACTGTTGTTGAGCCTGCCTTGAATGTTGGTCCTGT
TAATCCGGCTGTACAGGTAGAGCATGGAGAGAATTTGGCAGTGCCAGGCG
ATACCCGTGTTAATTCTGTCGAAAATGCTGTGCTTTCAGAGGACACACTG
GTGCAAGCAGATCAGTTGTGCTCCAATGATGAGGTGCTGAGTGAGAACAC
AGAAGCTCTTACCAAAGACAGTCAGGTTGAGCTTTCAGGAGATCAGGGTG
GGTATCTTCCTCAGTCGGATGTTGATTCTGGAGTTCAGCCAGGGGAGAAG
GTGGAGAGTGAAGATTTGCCAAGACCACCAAGACTATCACGGGTTGCTCC
TCCTGATCTTGATGAATTCAAGACAAGAGCAATTGCTGAAAGGGGACCTG
GTGTTTCTAGTCAACCTGGTCATGTCATCCACCGAAGGGAGCCTAGTGGG
AAGTTGTATAATTATGCAGCAGCATCTAAA
View all "lga110" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgc114 ACCCTTAGCTTCCTCCAAATCCATCGATCGTCACCATCCCGACCCCAATC
CCAGCCCCGCCCCGCCCCGCCGATGATGCAGCAGCACCAGCAAGAGGACG
ACCCAGCACCGCCACCCGCAGTCGCCGATCCCGACCCTCCGCCGCCCCCC
GACCGCGGTGATGCCGCCGCCTCCGCCTCCCGCAACGCCTCCTCCAAGTA
CGATTTCGTCAAGGTCAAGGTGTGGCTCGGGGAGAACGCCGACCACTACT
ACGTCCTCTCCAGGTTCCTCCTCAGCAGGATGCTCACCGTCACCAAGGTC
CACACTCACTACTAAGCAATTTCCTCTTTCCTTTCTTCTATCTATCTATA
TAGTAGGAGTACGTAATACTATCTCTATAATATGTCAATCAATTAACCCG
TCCATTGTTCCCCTT----ACACACACACACACACAC----------GCA
GATTCCTAATCATGTCGCCATCAAGATTGCCCTTGAGCTCAAGAAGCTGC
TTGTCGACAACAGCCTG
View all "lgc114" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgc114 ACCCTTAGCTTCCTCCAAATCCATCGATCGTCACCATCCCGACCCCAATC
CCAGCCCCGCCCCGCCCCGCCGATGATGCAGCAGCACCAGCAAGAGGACG
ACCCAGCACCGCCACCCGCAGTCGCCGATCCCGACCCTCCGCCGCCCCCC
GACCGCGGTGATGCCGCCGCCTCCGCCTCCCGCAACGCCTCCTCCAAGTA
CGATTTCGTCAAGGTCAAGGTGTGGCTCGGGGAGAACGCCGACCACTACT
ACGTCCTCTCCAGGTTCCTCCTCAGCAGGATGCTCACCGTCACCAAGGTC
CACACTCACTACTGAGCAATTTCCTCTTTCCTTTCTTCTATCTATCTATA
TAGTAGGAGTACGTAATACTATCTCTATAATATGTCAATCAATTAACCCG
TCCATTGTTCCCCTT----ACACACACACACACACAC----------GCA
GATTCCTAATCATGTCGCCATCAAGATTGCCCTTGAGCTCAAGAAGCTGC
TTGTCGACAACAGCCTG
View all "lgc114" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgg112 ACCTTGCACAGGTATTGTGGTGGTTCTAGATTCCAAATCATTATATGCAT
CAAGTGTCACAAGCCATGAATCACA-TGAAATGATTAAAATTATATATTG
CTAAAATTTAACCAAATCTATCTAAAACATGCATGATTGGATTGTAGCAA
AATTTATGTG-TCATTCACACTATTTTGTTGTCCCCATGCTTCTGTCAGT
CTTGAATCCAATTACTGAACCTACTAACAAATGTCATTTTTCCTTGTGAA
GGTCATCTGACCACCAAGAGCGATGTGTACAGCTTTGGAGTAGTACTCCT
AGAAATGTTGTCAGGACGCCGCGCACTGGACAAGAACCGCCCAAATGGGG
AGCACAACCTGGTGGAGTGGGCTAGGCCATACCTGAGAAGTAAACGGCGC
ATATTTCGCATCCTGGACCCCCGGCTGGGTGGGCAGTACTCCCTTGCTAG
GGCGCAGAAGGCTGCAGCGCTCGCATTGCAATGCCTCTCAGTGGAGTCCA
GGCACAGGCCCAGCATGGACGAGGTGGTAACAGCCTTGGAACAGCTCCAG
GACACGAAGGAAGGTGGTAACCATCACCTAC
View all "lgg112" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lge107 ACTACATGGCAAAACGTCTAGAGGTACTTTTTCATTCAGTGACAGCATAC
CTTAGTGACTTTTGTTATATTCATCAAATTAGTTTAAAATTTACTTGGTA
ATGATCATTTTTGCAGAAACACTACCCAGTTTTGTTCCGTGGAGTCAATG
GAACTGTTGCCCATGAATTCATCATTGATTTAAGAGGATTTAAGGTACTT
GTATCTGAATCATACTAGCAATCCAACCATGCATCGATGCATTGCAGTCT
CTAACCGGCTCCTGGAACTTTGTCAGACGACTGCTGGTATAGAACCAGAG
GACGTGGCAAAGCGCCTGATGGACTACGGATTTCACTCACCAACCATGTC
ATGGCCTGTTCCTGGCACACTTATGATTGAACCAACTGAAAGTGAGAGCA
AGGTAAGCATATGTAGCTTTTGGTAATCTTTTGCTTCCCATTAATATCAG
TTAGTTGATTTCACATTAGCTTATGATATCA-TAACATTTTGTCGTCGCG
GCAGGCCGAGCTGGACAGGTTCTGTGATGCTCTTATCTCCATCAGGGAAG
AGATCGCAGAGATAGAAAATGGCAAAGCAGATGTGCTCAACAATGTCCTG
AAGGTAATATCTC---AGTGTCAAAAAATGGTATCAGTCAGGTAGCATTT
GTTCACCATATCAAGCCATATCTCTCTTCACATAGGTCCTTCTGAATCAT
ATTCCTTGCCTGTTGGGTCTGAATAACTTTAAAGAAAGAAGCGATCACTA
ACTGTAAAGAGTATGTGTCTTTTAGCATGCTAAGTCTTCCACACTGGAGA
TGGTTTCGCAGTCACACAGCC
View all "lge107" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgh110 ACTAGATGACACAGCAGCTTTCAAGAACTTCAAGAAGTGAGTCTCAGATT
CCCAGGGACACCATTTCTTCATGTCATGGTTGGATTTACTCTTAATTATC
AATTGTGCAGGTGGGGAGATATAGAGTTCCCTCTACCTTTTGGAAGAGTA
CTCAGCTCTACAGAAAGTTTCATCCATGAACTTGATGAGAAGGTATTGAT
TGCAGAGCTATGTTTTTATCTTTCCTTTTTGTTTCTGAGGTCTATCACCT
ATAAAATAATCAGTTTCCATGAGAAATACTGGATCTGCAATACATTTTGT
TGACTTGTGTTGTTAATTCGCCAACCTTGTTATTTCAGACAAGTGCCTCT
CTGAAGTTCACAGTTTTGAACCCAAAAGGTCGTATCTGGACAATGGTTGC
GGGTGGTGGTGCTAGTGTCATATATGCTGATACAGTAAGCATCAATTTGT
ATCCTATTTTTATTTACACATAAAAAGATTTTCACGATGATGCCTGTTAA
ACTGTTCACCCATATTTAACTGCCGTGATGAAATTAATTCCCCCCATGTA
CCAGGTTGGAGACTTGGGATACGCGTCAGAGCTTGGAAACTATGCAGAGT
ATAGTGGTGCTCCTAATGAGGAGGAGGTTCTGAATTATGCCAGAGTTGTA
CTTGATGTAAGCAAACACTGTAACCTTGTCAATGCTGCTCTTAAGTCTTA
ACTCCACCTTTGGACCATCTTCTGGTGGGGACAATGTTAGGATCATCTGT
TAACTGTACAATTAAATGCAGTGTGCAACTGCTGATCCTGATGGCCGCAA
GAGAGCCCTTCTCA
View all "lgh110" genotypes
[ Download ]