grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "Purdue No. 49018" from the experiment "Hamblin, Casa, et al. (2006) Challenges of Detecting Directional Selection After a Bottleneck: Lessons From Sorghum bicolor. Genetics 173: 953-964.".

E.g., Germplasm L-WA58, Marker/locus pSB0080.

Items 1 to 25 of 216.       of 9 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
Purdue No. 49018   bicolor, NULL Cameroon   lga109 GAGGGACCTAATGACATCCCTTGCCAACTCCCGCCCATGAATTTTTTTTC
CTCTTCGCATAAATACATGTCGCCTGATTCCCGATCTAATTTTTGCTGGG
CAAACAGT-ATCGATCGTTCC--------------TGCAGAGCACTAGAT
TCCGTGCACA------------ATCGACAAAGGCGTGTATGCATTGCAGG
CTAGGCGCGACTGAAATGGGGCCGCGGTTTCGCCATCTTTTAGCTCGTTT
TTTTCTTGGCACGCGCGCTCGAGTGTGTCCGTATCCTTTCCTCGG-ATAT
CCAGCACGACTCTCCCACTACCATATCGTCGCTCTCGACGAGACCGAGAC
AGCGACGGAAGAGGAGAGCGGCGGGCGAGACGAGAGACCAGGAGGAAGAA
GATGGCCACCTATTTCACGCTCAACACCGGGGCTCGCATCCCCTCGGTAG
GGCTCGGCACCTACAAGGCCGGCCCCGGCGTCGTCGCCGACGCAGTCACC
GCCGCCGTCAAGGTCTTCGCCGTTTGCCCCTCCCTCGAGCACTTCTTGTT
CTGAGTTTTACATCCGTATATGTTCTGTGCCCGTGTACTACCTGTACATG
CGTGCTGCTTAATCCTGCTTTCTTGCTTGCTTGTCATGGCAGGCCGGGTA
CCGGCACATCGACTGCGCGCCGCTATACAAGAACGAGAAGGAGGTAGCCT
TAACCCAGTCCCTGCAATTAGTATCTTCGATTCACATTTGCGATGGCACT
TTGGTTATAGTTGCCCTTAACGCGTATCCTAGATTGGCGTTGCTCTGAAC
AAGCTCTTCGATGACGGCGTCGTCAAGCGAGAAGACCTTTTCATCACCTC
AAAGA
View all "lga109" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lge5 TATGGTGTGTTTTCTAGTTCTTCTCACATTTATCTGTGTTTCTACTTTGC
AAATGCTTTTAGCTAATCTTTCTATTCTTCCTTCTGATGTTATGACCTAA
GTAGACCAGCTAGATCTCTCCATTCCTAATTAAACCGTTCCATAAAGTTT
CTAATTAAACTGATTTTAGTTATGTTAATACTTAACCCAAACCCATGTAC
GTTTCAGCGGCTTAGGCAGTCTTAATAACAATTGCAA-------------
---TGCCGACTTAGAGCATCCCCAACCGTTTTGCATAATTGGTTTGGCAA
ATGAGGGAGTTTGCCAAGTCTCAAAATAATATGGCAAATGTGAAAAGAGG
CAATCTCCAATGGTTTGGCATTAATCACTTCGTGCCAATTTCCCAATGCC
AAGTGTGAACAGGTTTGGCATATATGCCAATCCTTCCTCTCTTTTTGCCA
AGTTAACAAAATTGCAAAGTCTAAATGCCAAACCGTTGGATAAGTGTTTT
TAAGACTTTTTTGCAAATACATGAATGCAAAGCTTATTTGCAAAACGGTT
GGGGATGCTCTTAGAATAACCTTCAGGGAGTTTAGTAGGTCACTGCAGTT
TGTTTGGGTTACTTATATTAGGCTAAGGGTTATTACATAATGAGCTGCCT
GAAGAACCTGGGCCATTGCTGGAGCCTTGTACCAATGGACATTCACTGGT
TTGGTGTGGGCAAGAGCAGCATAGCTAGAGATGCGCTAAGAAGGTGATAA
CTGAAGGGTGTGTTTGGTTTGAGGAATCAACTTATCCTAGATGGAGTGAT
GCATCCGTTCCATTCCTCAAACCTGGTGGAATGTCCTCATTCCTCATACT
AGTACTAATTATTAGCT
View all "lge5" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lge5 TATGGTGTGTTTTCTAGTTCTTCTCACATTTATCTGTGTTTCTACTTTGC
AAATGCTTTTAGCTAATCTTTCTATTCTTCCTTCTGATGTTATGACCTAA
GTAGACCAGCTAGATCTCTCCATTCCTAATTAAACCGTTCCATAAAGTTT
CTAATTAAACTGATTTTAGTTATGGTAATACTTAACCCAAACCCATGTAC
GTTTCAGCGGCTTAGGCAGTCTTAATAACAATTGCAA-------------
---TGCCGACTTAGAGCATCCCCAACCGTTTTGCATAATTGGTTTGGCAA
ATGAGGGAGTTTGCCAAGTCTCAAAATAATATGGCAAATGTGAAAAGAGG
CAATCTCCAATGGTTTGGCATTAATCACTTCGTGCCAATTTCCCAATGCC
AAGTGTGAACAGGTTTGGCATATATGCCAATCCTTCCTCTCTTTTTGCCA
AGTTAACAAAATTGCAAAGTCTAAATGCCAAACCGTTGGATAAGTGTTTG
TAAGACTTTTTTGCAAATACATGAATGCAAAGCTTATTTGCAAAACGGTT
GGGGATGCTCTTAGAATAACCTTCAGGGAGTTTAGTAGGTCACTGCAGTT
TGTTTGGGTTACTTATATTAGGCTAAGGGTTATTACATAATGAGCTGCCT
GAAGAACCTGGGCCATTGCTGGAGCCTTGTACCAATGGACATTCACTGGT
TTGGTGTGGGCAAGAGCAGCATAGCTAGAGATGCGCTAAGAAGGTGATAA
CTGAAGGGTGTGTTTGGTTTGAGGAATCAACTTATCCTAGATGGAGTGAT
GCATCCGTTCCATTCCTCAAACCTGGTGGAATGTCCTCATTCCTCATACT
AGTACTAATTATTAGCT
View all "lge5" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lge2 CCGCCATCGAATTCGATGGCGGCCAACGCCGGGAACAAGATCCGCAACGC
CAAGCTGGTGCGAATTCCTGTCCCGACCGCTCAATTTCAGTTCTTGGTTT
CGCCGCAGATCGAAGCCGGCCGGCCGGATCTTGATCGCCAGTACTGGGAT
ACATGGTGCTTAGCGCGTGGGGTTGTTATGATCGTATACTTCCTTTGCCT
GTGGATTATTGCGTTGCGCCGGGACCAATAGATGGGGTCCTTACTTTTAT
GGTTGTTGGTAGAAGTTTTAAGAATTTATGCCCTTTTCTTTTGCGAATTC
TATATGGATATAAGTGTTTTGACTTCTTGGTAATTTATCCGAAGAGAAAT
AGTAATCGTAACTTTAGCTGGTAAGGTTGTCAAATGTAGAGTGATCAGTT
TAGTTGACCTTTGATACTGGTGGTAACTGAACTCCTAAATGGTCCCTGTT
CAAGTGTTCATGAATAAATTCCGTTGCTCGATGTTTTAGGGAGCTTGCAG
TTTGCATTTTAATCATTCGTCATGTGAATGCTAGTGTTTTATTGTATTTT
GATTTGTCAGGTTCTTCTTGGAGATGTGGGTGCTGGCAAATCTAGCTTGG
TTCTTCGGTTTGTTAAGGGACAGTTTGTTGAATTCCAGGTGAACCTATTG
AAATACTTCTCGCGCCGAGAGTGTGGACCAATAGTTTTGTTCTGA
View all "lge2" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgj107 TATTATCTCAGCCACCAGACACGATACATGGGTCGCTTCGTGTAACAGTT
CAAGGCGAAGTTATTGAGCACTCCTTCGGAGAGGAGCTCTTGTGCTTTAG
AACTTTGCAACGCTACACTGCAGCTACTCTTGAACATGGCATGCATCCTC
CAATTTCCCCCAAGCCAGAATGGCGTGCTCTGATGGATGAAATGGCTGTT
GTAGCAACTAAAGAATATCGATCAATTGTCTTCCAAGAACCACGCTTCGT
TGAATACTTCAGATCGGTAGGTTTCAACTGTATCCATTATTCTTACAAGT
ATAACAATTTGCACTTGCACAAGCATGATA-------GTTTCAAAGCTGC
TAAAAGTCCCAAAAGAGTGCACTTAAAGATAGGCTGCCTTTTGTCAACCT
ATTAATTGGTTCTTTAGAAAATTTGAACATATGTAGTTTTCTGCAAATCC
TTTTTAACTGAAACATCCTAGAACACTAAGTGGACATAGACCAATTTGAG
AAAAAAACCAAGACAAATGCTCTTGTTTTTCTAGGTAGGATATAATTTTT
ACCAAGGCATTGGTGGCATACAAGTGAATGCACTGAACTGTATGCATTGA
CCAATAAGGACTAAAACATTCTTTTTATCTTATTAAGCATGCTGTGTCTC
ACTGCATGATGATTCAGTGGGGTGCTATTAANNTGGTTCTAGAAGTCCCG
TATGCGAACTAACTCGATCTTATATTCTTTCAGGCTACGCCTGAGACTGA
ATATGGTAGGATG
View all "lgj107" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgj107 TATTATCTCAGCCACCAGACACGATACATGGGTCGCTTCGTGTAACAGTT
CAAGGCGAAGTTATTGAGCACTCCTTTGGAGAGGAGCTCTTGTGCTTTAG
AACTTTGCAACGCTACACTGCAGCTACTCTTGAACATGGCATGCATCCTC
CAATTTCCCCCAAGCCAGAATGGCGTGCTCTGATGGATGAAATGGCTGTT
GTAGCAACTAAAGAATATCGATCCATTGTCTTCCAAGAACCACGCTTCGT
TGAATACTTCAGATCGGTAGGTTTCAACTGTATCCATTATTCTTACAAGT
ATAACAATTTGCACTTGCACAAGCATGATA-------GTTTCAAAGCTGC
TAAAAGTCCCAAAAGAGTGCACTTAAAGATAGGCTGCCTTTTGTCAACCT
ATTAATTGGTTCTTTAGAAAATTTGAACATATGTAGTTTTCTGCAAATCC
TTTTTAACTGAAACATCCTAGAACACTAAGTGGACATAGACCAATTTGAG
AAAAAAACCAAGACAAATGCTCTTGTTTTTCTAGGTAGGATATAATTTTT
ACCAAGGCATTGGTGGCATACAAGTGAATGCACTGAACTGTATGCATTGA
CCAATAAGGACTTAAACATTTTTTTTATCTTATTAAGCATGCTGTGTCTC
ACTGCATGATGATTCAGTGGGGTGCTATTAANNTGGTTCTAGAAGTCCCG
TATGCGAACTAACTCGATCTTATATTCTTTCAGGCTACGCCTGAGACTGA
ATATGGTAGGATG
View all "lgj107" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgc5 TGAGAGTCAAGTAGACAAGACCTTGAAGCAAATAAGATCAAGAAAGGTAA
ACTAGCTAATTAAATGGGAAGGGATTCAGATTCAGGATGAATGATGTCAA
TGGTATTTTTGCGCACAACAGAATTATAGTGAACAAACTTTTATAATGCA
TGCCTTGCCATTTTCCTCCTACCTTATATCTAAACCAATCCATGATAGTG
CGATTGGACTTGCATTCATTATTCATTCAATTAACTACTAGATGAATCTC
ACTTGAAAAGAAAGGATGCGGTGGATAAATGTTGATTTGTGCTACTTTCA
TTTTAATTTAAATTTGAAAATTCAAAAATAAAAGTTGAGGTTACACCATT
TAGGAG--ACATTTAACAGGTATTTAAAACATAGATAGACTGTCTTAATG
TAGATTTGTGCTACTTTTATTTTACCTGAAATTTGGAATGCCCCACCATG
TTGCTATCCAAGTAACTCTTCTATGCATGTCTTCATTTGCATTTGGCAGA
CTCAAGTGTTACTTGATGAACTTTGCGACTTAAAGAGAAAGGTAATATCA
CCGGAGCAATGCTACTCTGACTCTCTGTTTCCATACTGAAATCCAATATA
TGCCTGAGCATCCGGCCCTCATCTCTTGCAGGAACAAATGCTGCAAGATG
CAAACAGGGTTCTGAAAAGGAAGGTAAGTGACAGTTGAACTGGAAAACTC
GTAGCACGCACGGTTGGCACTGGCAGTAGTAGCCCATATAAACAATGGTC
CTTCAGCTACCTCTGCATTTGCCACCACAACTTTGAAGCTGAACGCCTGA
ACCGATGATGCCATGTGTATATGCAGTTCATAGCTGCAGTCTCTGCTTTG
CAACATTCCAACTCTC
View all "lgc5" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgj104 CTTCGAGGGCCATAAGTTCCAGGGCCCCGCCGCCATTGCCGGCAAGCTCG
GATCTCTCCCCTTCCAGGCCTGCCAGCACAAGATCGACACCGTCGACTGC
CAGCCGTCGGGACCCCAGGGAGGCGTGCTCGTCTTCGTCTCCGGCTCCAT
CCGCACCGGCCCCGAGGATCACCCCCTCAAGTTCTCCCAGGTATGCCCCT
CCGCTTGGCCTCGATCCTCCTTC---CCACTCGTAGCAAGGCTTATTTTA
TTGTGTCTGGTAGTGGTACGCGATGACTTGTCACCTGATCTGATCCGTTG
TCACTCCTGTGATTCCTAGGTTGGTTTGGCCCTGATCTCGCGGTAGTCCG
TAGAAGGCCCTTGCTTTGTTTGTTGTTTTGATTGAATGGTGCCAATCGTC
TGTGCTTACTGTTGTCATGGATTGATTGGTCTCATGATTATCAGCTTAGT
ATAAATCTGTTTGTTGTTTTGATTGAATGGTGCCAATCGTCCGTGCTTAC
TGTTGTGATGGATTGATTGGTCTCATGATTATCTGCTTAGTATAAATCTC
TGGTCCATGATCCTTGTGGCGGAGTTTGTTAACTGTTCAGAGCATTTGTT
TTTCCTACTAGGCAGCTTGTTTCGTTTAGATCTATATGTAATTGTTTATG
CTAGTCCTGGATCGATCCATTTTTCAGTTCTG
View all "lgj104" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgg1 TTGCTGAACATATATATAATGAAATTGGCAGGAGGCGATGAAGAAGGACA
CCCTGGAACGTGCCCGGGAGCCCAACTTCGATCTGAAGGCGTACCTGGCC
AACTCGTACCTGCACCCGGTGTTCAAGGGGGACGAAGGCGACGACAGGTA
CTCGGTGGTGGATGACGAAGGGTGGATGGAGGAGGAGGTGATTGTGCCGA
CGAAGCGGCATTCAAGGAGGACGACGCCCGCGCAGAGCAAGCACGAAGGA
TCAGACTCGCTCTCTGTGCCCGAGAGCCAGCGATAGCCACTAGAGTAGGT
AGCCTGTACAGAATGGTTGAAAATGAGGGAGATGCTGCTCCTGCTCTATT
TC-TTTGTTTTGGGTTGGTTGCTCATGACACTGCTAGTGGTGCGTACAAT
TGAGAATACAAGCGGTATACATACAGACATGTTGGTTGATCTGCAACCGA
TCTCATAGAACAGAATTCAAGAGAGCTGGGGTAGGACTGAGGGGGAGAGA
ATGTTCACTGTAGCTTGAGCAAAGAATATGAATACAACAGTTACATTATC
TGATCTGATGAATTTGTTAGCATCATCCATCCATCTCTAGAGTTCTACAT
A-ATACATCACCTAGCTTGGCCGCTCTCCTACCATTCTGGTAATCGGAGA
ACAGTCAAGTAAAAACAAAAAATGCTCTAAATTAAGACAAAAAACTTGAC
GG
View all "lgg1" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgh5 ATTCCAACCCGGAGATCAAGTCGTTGCTAAGCTGTACTCACTTGTAAGCA
CATCAT-GCTCTTCACTTGTTATTTTGCCAATATATGAAGGCATTCCAAA
AGTGAAATGTGGAACATTTAGTAAATCTTTCTGTAGTTCAAAGCTGTATG
TTGGATTGTTAGAATTATTTGTGGTACATGCAC-----CAGTCGATCTCC
ATGTCCTGTACATGTTCGATGTGCTCATCATTCATTGAAAGGGATGTTCT
GACTTGATGTTAACAGTGTCCTTTTTTCTTACCAGAAAGGAGGTGGACTT
GCGGAGTATGCTGTGGCATCAGAAACTCTGACCGTCAAGAGGCCTGCCGA
GGTATTTGCTGCTGAAGGCGCAGGGCTGCCTGTTGCTGCTGGTACTGCGC
TCCAGGCGCTTAGGACCATCGGCGCCAAGTTCGACGGCACTGGCAAGCCC
TTAAACGTTCTGATCACCGCGGCATCAGGTGGCGTCGGTCACTACGCCGT
GCAGCTCGCGAAAATGGCCGGTCTCCACATCACCGCCACCTGTGGCGCGC
GTAACGTGGAGCTGCTGAAGAGCCTGGGCGCGGATGAGGTGCTTGACTAC
AAGACGCCAGAGGGTGCCAGCCTGCAGAGCCCCTCGGGTAAGAAGTACGA
TGTTGTCATCCATTGCGCTGCCCGGATCAGCTGGTCGACGTTCGAGCCTG
TGCTGGCCACCACCGGGAGGGTGATCGACATCACCCCAAACTTCAGCTCC
ATCCTC
View all "lgh5" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgh5 ATTCCAACCCGGAGATCAAGTCGTTGCTAAGCTGTACTCACTTGTAAGCA
CATCAT-GCTCTTCACTTGTTATTTTGCCAATATATGAAGGCATTCCAAA
AGTGAAATGTGGAACATTTAGTAAATCTTTCTGTAGTTCAAAGCTGTATG
TTGGATTGTTAGAATTATTTGTGGTACATGCAC-----CAGTCGATCTCC
ATGTCCTGTACATGTTCGATGTGCTCATCATTCATTGAAAGGGATGTTCT
GACTTGATGTTAACAGTGTCCTTTTTTCTTACCAGAAAGGAGGTGGACTT
GCGGAGTATGCTGTGGCATCAGAAACTCTGACCGTCAAGAGGCCTGCCGA
GGTATTTGCTGCTGAAGGCGCAGGGCTGCCTGTTGCTGCTGGTACTGCGC
TCCAGGCGCTTAGGACCATCGGCGCCAAGTTCGACGGCACTGGCAAGCCC
TTAAACGTTCTGATCACCGCGGCATCAGGTGGCGTCGGTCACTACGCCGT
GCAGCTCGCGAAAATGGCCGGTCTCCACATCACCGCCACCTGTGGCGCGC
GTAACGTGGAGCTGCTGAAGAGCCTGGGCGCGGATGAGGTGCTTGACTAC
AAGACGCCAGAGGGTGCCAGCCTGCAGAGCCCCTCGGGTAAGAAGTACGA
CGTTGTCATCCATTGCGCTGCCCGGATCAGCTGGTCGACGTTCGAGCCTG
TGCTGGCCACCACCGGGAGGGTGATCGACATCACCCCAAACTTCAGCTCC
ATCCTC
View all "lgh5" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lge11 TAAAGTGAACCCATAACCGATTTTATTCAGCTGTGTTTCATTAGGACTAT
GTTAGTTCAAATATTCTGATCACCTTTGTTGTAGGTCCTAGAAGACCAAG
GCTATGATGGTGCAATGGCTGATTTGTGGTCATGTGGAGTTATCCTGTTT
GTTCTGCTAGCTGGGTATTTACCTTTTGAGGACTCTAATCTTATGACGCT
GTATAAGAAAGTGAGCATTGCACAGATTTAAGACCACTGACGTAGCCTTG
CTTATTCACTCTTATTTGACTTTATCCTTCCATTCTTGGCAGATATCGAA
TGCAGAATATACATTTCCACCATGGACGTCTTTCCCTGCCAAGAGGTTGT
TAACAAGAATCCTTGATCCAAATCCAATGACGGTATGCAAGAGCACAAAA
GCTGCTCGAAATAAAATACTACCAAAACAATCTAGGAATTTTGGAAACCT
T--AAGTCCCTATTGCACTTACTAGCAGCACATAGCCAGTGATAGATGTA
TTTGGGGGGATTAAAAAACCGGAGTTC-----TCTTTTAGGAAAGTATAT
AGATAGCATGCATATATCGAAATGAAACTATTTGTGTGAGGAAAGACTTG
CAACTTCCAGTCGAGGAGGCAAAGTTGCAACTGGATTGTGGTTCATCTTC
AACATGAGGATGTGCTGAGTCTGGTTTGAAGGATGAGCCTTTATAATTCT
ATCTTGCTCCATAACATCAGTCTAATGTTTCTGGTAAACCATGGCAGAGA
ATAACAATCCCTGAAATACTGGAGGATGAATGGTTCAAAAAGGGCTACAA
G
View all "lge11" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgb14 CGATCATCTTCTTCATTCGTCTCAATATATATATTCTCTGATCGATCGAT
CGATCAGGTCTCCATCCCTCGATCAGCTCTAGCTAGCTACCTTCTTGCTC
GATCGATCCATGATCACCGCAGCCGGCCACCGCGAGGCAACAAAAATCTA
GCCGCCGGTCGGCGATCGACAGGCCGCCCGCCGGCTGCGACGACGACGGA
CTACGTGGTCGC---CCGGATGCAAGCAACAGGCCACACTA---GTCCTT
ACAATGCCGCCGTGCCGCCTGTTGCTCACTCCATCGCCATCGCCGCCGAC
CACCGTCCTCCACCAGTGGTGAGTATTTCAAATTTTCAATTCAGTTATAT
TATAGCTATAGCTATTATGCCCATTAATTAATTTCATCAGATTATTA---
-GGACCACGCACGCACTATATGTTTATTTGCATTTTTGGAAAGAGGAAAC
ATGACAGCATTGCACTACCTCTACT---AGCCTGAGAGCCTGACTAGCTA
----CCATGCTGAGAGACTTGCGTTTGATTGGTTT---AACCGACTTCTC
View all "lgb14" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgc21 AACCAACCAAATTCACCTGTTCCGATTGTTTAATGCGACATGACAAGCTC
AAACGACTTGTTCCTGTTACCATTTGAAAAGGCTCGCCGGGATCTCAAAT
TTATTGTGGACAA----TAAATAAATAAATAAATAAACAAACAATCTAAT
TTCATTTCCAGATCTACTACTGTAAATATGATCAGACAAGCGGGCAGACG
CCGGTTGAGCTTGAGCCTCTGCCTATACTCCTGCTGAATAAACAACACAC
GCTACTGCAGGGCAACAATTACACATACAGCTACGAAACAGCCACTTTAC
ATCCAAATCCAATCCAATCACCACTGCAGGAT------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
---------------------GTACTAACTAACGTCTCAACTCGAGTCTC
GCAGTACCTATAAAAATGCCCAATGTCAGTCACTCGAAAATCTGGGCAGA
ATGGTTCAGCATCGCCCACTTT-----ATACTACTCTAGCACGAGCATCC
CTACTGGTGGTTTCAGTCTTCACGTTATCATCGGCATCCGCCTCAGGCTC
GCACTGCCCGCTTTCAGGGCCAGAGACCTCCCCTGGGCTCCGTTTCTGAC
TATCCTCCACCCCGCCGTTGTCAGAATCCATTGGTGCCGCCCCTTCTTCT
GGATCGCCACCACTGCCACCGCCATCGGTTTCTGGTGTCGCAGCAACCTG
CACAGAGCAG-CCATAGCAACAATGTAGACATGACATTGTTGGTGTTTAC
AGATGATGTTAAAATGACAA-TTATGATCAAGAAGACAGTCGA
View all "lgc21" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lga103 AGCGGGTGCTGCTGCTCCTGGCTTCCAAGGCTACACAGGCTTCAACCACC
CGTCCTATGCTGCTGCCGGCTATGGAGGTCTTCAGCAACAGCATCTCCAG
CAGCAGCAGAGCAACAACCTCATGGCGAGCATGCAGGGGTACCATCATCA
TCCTGCAGCGACGGCCGCGATGATGAACAATTTGAGGGGTCTGAATAGCA
ACATGATGATGATGCATCAGCCCCAGCAGCAGCCGCAGATGATGTACCAC
TCCTCTCCCCAGATCAGCCCTTACACTGGCTACTACAACCCTTACAATTA
CTACTACCATCCCCATCCTGGCAGTGCTGGTTACCCAGCCAGCAATGGGG
ATGTGGAGACCATGTTCAGTGATGAGAACACCAAGGGCTGTGTTGTCATG
TAGGGATGCAGCTACAATCCTATAATCTAGAGGTTGGTGATGGACCATGG
TAATGGTGATGCAGTCCTGCTACCC-TTTTTTTGTTTCTTTTTTGTTTCC
TTTAATTATTTTACTGCTCTTATGGTTTCGCCTGTATCAAGAGTGAATCA
TGGTGTTGACTTAGATGTGTTGTTGAAAGTAGGGGCAACTTGAGAGGGTT
ATCAAACAGTGTAATGTAATACCTTTTAGGCTTTTACTGCCTAGTGCTTT
GCCCTGACTGGCTTGTTATAATTTGTATATTGTATATCTGGGTGTTTGTG
GCTTTGGACTTGTATGCTGTGCCATG--------TTATTAGTGCTGCTCA
TGACCGAGACTAACAGTGGAGGGGGTGAACAACTGTTAGCAGTCAACATT
GGGGGTGATGCATT
View all "lga103" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lga103 AGCGGGTGCTGCTGCTCCTGGCTTCCAAGGCTACACAGGCTTCAACCACC
CGTCCTATGCTGCTGCCGGCTATGGAGGTCTTCAGCAACAGCATCTCCAG
CAGCAGCAGAGCAACAACCTCATGGCGAGCATGCAGGGGTACCATCATCA
TCCTGCAGCGACGGCCGCGATGATGAACAATTTGAGGGGTCTGAATAGCA
ACATGATGATGATGCATCAGCCCCAGCAGCAGCCGCAGATGATGTACCAC
TCCTCTCCCCAGATCAGCCCTTACACTGGCTACTACAACCCTTACAATTA
CTACTACCATCCCCATCCTGGCAGTGCTGGTTACCCAGCCAGCAATGGGG
ATGTGGAGACCATGTTCAGTGATGAGAACACCAAGGGCTGTGTTGTCATG
TAGGGATGCAGCTACAATCCTATAATCTAGAGGTTGGTGATGGACCATGG
TAATGGTGATGCAGTCCTGCTACCC-TTTTTTTGTTTCTTTTTTGTTTCC
TTTAATTATTTTACTGCTCTTATGGTTTCGCCTGTATCAAGAGTGAATCA
TGGTGTTGACTTAGATGTGTTGTTGAAAGTAGGGGCAACTTGAGAGGGTT
ATCAAACAGTGTAATGTAATACCTTTTAGGCTTTTACTGCCTAGTGCTTT
GCCCTGACTGGCTTGTTATAATTTGTATATTGTATATCTGGGTGTTTGTG
GCTTTGGACTTGTATGCTGTGCCATG--------TTATTAGTGCTGCTCA
TGACCTAGACTAACAGTGGAGGGGGTGAACAACTGTTAGCAGTCAACATT
GGGGGTGATGCATT
View all "lga103" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgf7 AATCTTTATTTAGCTACTATATGTTGCTTGCAAAAGCATTGTTTGATGCT
TGCCTTTCCTCCAACAAAATTGCATATATCCCAAGGCAAAACTGAAAACT
TAAGATTTTATTGCCTTTTGAAATGTGCCATTCAAGAACAGGATTGATGT
TTCAAATCTGCCTTGTGCAGATGTACGCAATGCTAGAACGAATTAGCCCA
AGGACAAGGAAGTTGGAACTGTTTGCAAGAATGCATAATACACAAGCTGG
GTGCGGACTAATCGTTGCCTCTCTTCTTGGCCAAGTTTTCTGTCTCATTC
TAACCAGATGCACACTATTATATTTCAACTTACATTTTTCTCCTGGGCAG
ATGGCTTTCACTGGGTAACCAATTACAAGGGGTAAGGCTTGTTGATGAAG
GGTTGAGAGCAAGGTACAAGGCTGCTTACCCCGATGTTGAGGTCCAGCCA
CTGTCTCCTCCCAGGACAAGCGCACCAATGGATGTTGACCAAAGTAGTTC
ACAGAAGGCTGCTGCGCCAGATGGTGGCGAGAGGCCCGCCTGATGCTTGC
AAACTTACTTGCAAGTCACCGTGTCAGGACCCACTACTGATCATATAGTT
TTCATCACTGTTAGCGTTACCCCTGTTGTAAAATTAGGCAGCTC
View all "lgf7" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgc19 TCCGGTGACCCGGCCATGCCACCCCCGCGCGCGCG----GCCGGTGGCCC
TCTGCCCGCCATCTAGCTAGCTGCTGCAGCCGCCAGCGCAGCTGCACTGA
AGACGACGACGACAGACGAGCTTGCTTGCTCGTTTGCTACGACGACGACC
TTAATTATGTTACTTTGTTTTTAATTTCTTCTTCTTCTTCT---TCGGAT
GTTGTGTGTTTGTTTCCGTGTTTAATTAATTCAAGAGCAAGAGCTCTTGC
TCGGAAGAGACGACGACCAAGGGTTCTCTCGATCTTCTCGTGTACCACGG
CATGCTGATGATGCAGGGGTTAGTAGAGATATATATGGACTTCTATTGAC
CGACTAAGCAGGTACCACGTACTGGTAGTGGTAGGTTTGTAGTTGCAGTA
GACTACTGTAGCAGCTCTATATATGTTGCAGATGCGTCCGTCCTGAGAGT
TGTTGTTTTGTAGATTGCATGCCGCTCTTGTCTCTGTCCTTAGCTTGCCA
ATGGGCAGACAAGGAGCTTAACGACGACCACTCTGTCTGCAGGAGACAAA
TATATATACTACCATGTGCTTTCCCTGTCTTTTATTTCATCCTGATGTAA
CTTGCATGG---TAATGTACTCCATCCATCCGTCATTTTTTTGGAAGATG
TATCTTAGTTCTTTTA-GAAAAAAATGTTTAATTATTTCCTCACAGTGAA
TTGAAAATCAAACATAGAGCTACCTAGCTCCTAGTCTCCTACCATGCATT
TGCTCTTAACAAACTTTTTTTTTCTGGATGAA
View all "lgc19" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lga10 CTACGATGAGTGTCAGAGGAAGTATGGCAACGCCAATGCATGGCGGTACT
GCACTGATGTATTTGATTACCTTACACTATCAGCAATCATTAATGGCCAA
GTAAGTTCCACTAGGGAAAAAATTACAGGTTCTCATTTCATGTTATTTCG
GCAAGTCATACTTAAATTATATGCTGAATTCAGGTCCTCTGTGTTCATGG
TGGTCTTTCTCCCGATGTACGTACTATTGATCAGGTCTGTGA-----CTT
CTGTAACTTTCTTATAACCATCTGTGAACACATCTGTTTATGAACCCTTA
AGTATGACCCTTCCCATTTTATGGGATTCTGAGTTTCATGTCTTTTAGGT
TTGCCA--TACTTGGTGAATACATAAGTAGAAATATTTTTCACATGGACT
ATAAAGGATATGCATAGCCTTAAGAATTACATCTATTTGAAAACTTCACC
ATTATCAGTGATATAAATAAAATGCTTCAGTGGATATATGCTGGAAGTTT
GGAAATTTTGAATATTAAACAGCAGAAATGTTGTTTTCAGTTATTTTGTT
TTTTCTGTTCTTATTTTCAGCTGGTTGTGCTAACTGTACTTTTTT-GGAC
GTGTTTCTGATAGAATTTCCTTTGGTAATAAGAATGCTTATCATCAATGA
ACTAGCATTGCTGACTCATTTTGTGAAGAATATTGAGCACGTGATTCTGG
GGTTGATTTGGTCCTTAGAATTTCTTACTCATTTCTTGAAGAATAGTAGT
GCATGATTATGTGGTTGATTTTTATTTTGACTACATATTTCAATGAGATT
GAAGCTTTGATTACCTTTTCACCAGATACGAACGATTGATCGCAAT
View all "lga10" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgf4 TCATGATCTGTCCGAATTTATCCCTTCTTTTTCAAATGTACATATAAGCG
GTGTAATTTTCGATGATTGTTA-TTTGCTGCCTTAAGCTTTTTCTGAACT
TCTCTGGGAGTGATCAAATGGACATATAAATTATCTGCCTTATTTTCCCT
TTCGCTTTGCTTTGACTTGCAAGTATAGGATCCATAAGCTTTTATGTCTA
TTATTTTCCAACAAAAGTTTAGTCAGGGCAGCTTGTTTTCATTGTAGTTA
TATAACATTTTGGGCCGGTAAAGCATCCTGTTCTTTTGTAAGTGTGTCTA
CTCTATTTCTCTCTATATGTATCTAACCTTTTAAGCATGCAGGTGGAAGC
GGCCAAAGGTTTCTTGGCAGTGCTTAGAGACTACCTTGACACACTATGCT
CGAACTTGAGATCTCATACAATTACCAATGTGCAATCTAACAATGACAAG
GTTTGTTCTCCTGCCTTTGCTGAGATTTTGTCCTGGATGATTTAGTTCTG
TTTCTATATATATGCAAAATATAGTATGAACTGAGGATACTTTTTTTTAG
TATGAACAGTGGATACCATACCACATTACAGTTTTTGTTGGATGTAAAAA
TTGTGATGTTGTATAGTATCACTAGGTATACTTTTTGGCATGCTTATACA
GTTGTCAGAATGCTGGTTGCTGACTCTATTTTTCTTTGCGTAGGTTTCCT
TACTTTTAAAAGAGAGCTTTATCGGTTCTTTCCCAATCCGGGATAGGCCT
TTTATGAAGGTACTAAATTACATTCTCTCCTTTG
View all "lgf4" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgh110 ACTAGATGACACAGCAGCTTTCAAGAACTTCAAGAAGTGAGTCTCAGATT
CCCAGGGACACCATTTCTTCATGTCATGGTTGGATTTACTCTTAATTATC
AATTGTGCAGGTGGGGAGATATAGAGTTCCCTCTACCTTTTGGAAGAGTA
CTCAGCTCTACAGAAAGTTTCATCCATGAACTTGATGAGAAGGTATTGAT
TGCAGAGCTATGTTTTTATCTTTCCTTTTTGTTTCTGAGGTCTATCACCT
ATAAAATAATCAGTTTCCATGAGAAATACTGGATCTGCAATACATTTTGT
TGACTTGTGTTGTTAATTCGCCAACCTTGTTATTTCAGACAAGTGCCTCT
CTGAAGTTCACAGTTTTGAACCCAAAAGGTCGTATCTGGACAATGGTTGC
GGGTGGTGGTGCTAGTGTCATATATGCTGATACAGTAAGCATCAATTTGT
ATCCTATTTTTATTTACACATAAAAAGATTTTCACGATGATGCCTGTTAA
ACTGTTCACCCATATTTAACTGCCGTGATGAAATTAATTCCCCCCATGTA
CCAGGTTGGAGACTTGGGATACGCGTCAGAGCTTGGAAACTATGCAGAGT
ATAGTGGTGCTCCTAATGAGGAGGAGGTTCTGAATTATGCCAGAGTTGTA
CTTGATGTAAGCAAACACTGTAACCTTGTCAATGCTGCTCTTAAGTCTTA
ACTCCACCTTTGGACCATCTTCTGGTGGGGACAATGTTAGGATCATCTGT
TAACTGTACAATTAAATGCAGTGTGCAACTGCTGATCCTGATGGCCGCAA
GAGAGCCCTTCTCA
View all "lgh110" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgh110 ACTAGATGACACAGCAGCTTTCAAGAACTTCAAGAAGTGAGTCTCAGATT
CCCAGGGACACCATTTCTTCATGTCATGGTTGGATTTACTCTTACTTATC
AATTGTGCAGGTGGGGAGATATAGAGTTCCCTCTACCTTTTGGAAGAGTA
CTCAGCTCTACAGAAAGTTTCATCCATGAACTTGATGAGAAGGTATTGAT
TGCAGAGCTATGTTTTTATCTTTCCTTTTTGTTTCTGAGGTCTATCACCT
ATAAAATAACCAGTTTCCATGAGAAATACTGGATCTACAATACATTTTGC
TGACTTGTGTCGTTAATTCGCCAACCTTGTTATTTCAGACAAGTGCCTCT
CTGAAGTTCACAGTTTTGAACCCAAAAGGTCGTATCTGGACAATGGTCGC
GGGTGGTGGTGCTAGTGTCATATATGCTGATACAGTAAGCATCAATTTAT
ATCCTATTTTTATTTACACATAAAAAGATTTTCACGCTGATGCCTGTTAA
ACTGTTCACCCATATTTAACTGCCATGATGAAATTAATTCCCCCCATGTA
CCAGGTTGGAGACTTGGGATACGCGTCAGAGCTTGGAAACTATGCAGAGT
ATAGTGGTGCTCCTAATGAGGAGGAGGTTCTGAATTATGCCAGAGTTGTA
CTTGATGTAAGCAAACCCTGTAACCTTGTCAATGCTGCTCTTAAGTCTTA
ACTCCACCGTTGGACCATCTTCTGGTGGGGACAATGTTAGGATCATCTGT
TAACTGTACAATTAAATGCAGTGTGCAACTGCTGATCCTGATGGCCGCAA
GAGAGCCCTTCTCA
View all "lgh110" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   psb1814 GAAGACTACCCAAGCAAGCCTCCCAAATGCAAGTTCCCACAGGGTTTTTT
CCACCCAAATGTTTATCCTTCAGGAACAGTCTGCCTCTCAATTCTCAATG
AGGATAGCGTAAGTGTTCATCAAACTGTACTTCACAGGCTTTGCCTAGCA
TTTTGTCTGCTGAGAATTTTTCATTTCTCATTGTACAATTTCAGGGTTGG
AGACCTGCTATCACTGTTAAGCAGATTCTAGTTGGAATACAGGACTTGCT
TGATCAGCCCAATCCTGCTGATCCTGCTCAGACTGATGGTTATCACCTAT
TCATCCAGGTTAGGAAGAATTAGTGATCATTCTGCTATTTG-TTTTTTCT
TTCTTTCTCTCGAGATTAATCAGC
View all "psb1814" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgi6 CGGCGACCCGGGAGAAGGGGCAGGGCAGCATCGCTTCGACGCGAACGAGC
GTGGGAGGGTATGATTGGGTGATCAACTACCACCCAAGAGTGTGGTTCTC
CGACCAGTACTGGATCATGTTCCGCATCACCTTGGACAGCAACGGGACAG
GCGTGGTGGCGTCGTTTGCCTGCCGCCTGGTGGACGTGGTGGACCAAACC
GGCGGCGGGCAGCATCTCGGCTCT---TCTTCTTCTCCGGTGCCGGCGGC
CATAACAAGCGCCACGCTTAGTAAAGGACAGGCAAACGATGTCTACATCA
CGACAAGGAGTAAGCTGGCCTCCTCCGGCTACCTCAAGGACGACTCCTTC
CTGGTGGAGTGCGTGATCACCGTCCTGATAGAGAATAGATCACCAACGCA
AGATGCTGCTGCGGCGGCGGCCAACCTTGCG
View all "lgi6" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgf19 CGATATGTTCATCGTTAAGAAGAAAAGACAAGATCGGGCAAGGAGCAGCA
TTGGGTCCCCCTCCAGTTCAGGCCGAGCTGGACCTCTCTCACCAGCCAAC
CCTGGGCGGCCAGGCCCAGTCCCCTCACCCAGAGGTGCCAGGACGCCCTT
CCAAAGGGATCCACACCCATCTCAGCAGTCGATGCATTCCGCTGGATGGG
GCGCGCATTCAGATCAAGGAGGAAGTTCTTCAGCACCCGGCATTGGAGAC
ATCCAGTGGGCAAAGCCTGCCAAGAGACTGAGGACCGACAGCGGCAAGAG
GCGGCCGAGCCTAATGTGAGGATTCTTTGCATCGCGGTGTGCATTCTCTG
GCAATCTTGATTTGCCTGGCCTATGAAATGTGGGCTGCACTGGTGGGGGC
TTGTTCGTGTAATTTTGGCACACAGCTGAGTTCGTTCTTGCATATATGAG
CACCTACATGCTGGGGCTTTTGTTGTTGTGGACATGAAGAAATGTGGAAG
GGTAGTGTTATTGTTCCTGTATGTTATTAGCTTCATAAATGTGTAAAGGG
AACTCTTATGGT
View all "lgf19" genotypes
[ Download ]