grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "Purdue No. 49018" from the experiment "Hamblin, Casa, et al. (2006) Challenges of Detecting Directional Selection After a Bottleneck: Lessons From Sorghum bicolor. Genetics 173: 953-964.".

E.g., Germplasm L-WA58, Marker/locus pSB0080.

Items 26 to 50 of 216.       Previous | of 9 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
Purdue No. 49018   bicolor, NULL Cameroon   lga6 ATGTCTCTCTTGACGCTCGAAATTTCATCTAGCTACTAGCTAGGACGCTG
TTCGTGTATATATATATAGTTCAATCTTCGTGTATGTATATATGCGTGGG
TGTCTGATCACGACGAACTGACCGATTCTGAATGCAACA---AAATACGC
ATTGCTG--CCGCACGCAGGGCCGAAGAAGGCGTGCTGCAAAGAGTGCAC
CAGCTGGTCGGGTGTCTACACCTGCGACGACCTCCTGACCAAGTGCGCCG
CCACCTGCAAGCAATGCGTCCCCGTGTCCACGGACAAGGGCACCCGCTAC
AGGTGCCGCGACTTCCTCCCCGAAGGCTGCCCCTGCAAGACCAACTGATC
CATCCATCCATCCACACCACGCATGCATGGCCACAGCCGATGGAT
View all "lga6" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lga7 CCGGAGTGATTCGTTGGAAGCGCGATCTGGATTGGGTGTGGAGAGTATGT
TTTGCTTTACGAATTGGGATCAGTTGTTAATCACTAGTAGCGAATCTGGC
CCTGAAATTGTTCCTAGGTACTCCGAGCTACGTACTGTGGGCTGTTTTCT
TATTTCAGCTATCAAATCTGTCTCTGAGATGGCGATAAATCAGAATTATC
GACCTTCCTGTTGTGACTACCTGAATGCCTTAGGCAATGGTGAACTGGTG
ATTACTCACCAGTCACCAGTGTTGCTTCAT-AACTCAAGTCTTCCGCATA
CTGCACCGCTGCCGCCTCATTTGACTTACACATGAGTCATGTGCACAATT
AGATCTTGTTGCCCCTGAGAATCACTTAGGATCAGTTTAATGACATTGGC
ATTGGTTGCAGTTTACTATTATAACAAACAAAATGAATATGAAAGCTTAG
ATTTTTTTTT
View all "lga7" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lga8 GATAATGGAGGTCCATACCCTGGTGGCTACCCAGCAAGTAATGTTCCTCT
AAATTATATATGTAGCTTAGCATTTCCTAAAACTATTATCCATATTCATA
TTATCAGCCTCATAACCAAACTATTATCGCAGTAGCTGACTGTAAAATTT
ACCTGAATTATTATCAACCTTCAGGGGATGATGCTTATCGCACTGCTGAT
CCAACTCCCAGGGGTGCTCAACCTTTGAAAGTGCAGCCAATTGCTGTCCC
CACTATTCCTGTAGAAGAAATTAGAGAGGTCACAAAGGCTTTTGGCGATG
AAGCTTTGATTGGCGAGGGGTCTTTTGGCAGAGTATATTTTGGTGTACTA
GAAAATGGTAGGAGTGCTGCGATAAAAAAGTTAGATTCAAGCAAGCAGCC
AGAGCAAGAGTTTTTAGCACAGGTGTGCATTGATTTTATCAATGAATTGT
GCATCTTTGCTAGTCTTTCTTCTTATAAAATATATCTCTACACCTGCAGG
TCTCCATGGTGTCAAGGCTTAAGCATGACAATGTCGTAGAGTTGCTTGGT
TACTGTGTTGATGGGAACACCCGCATCCTTGCTTATGAATTTGCTACTAT
GGGTTCTCTTCACGATATGCTTCATGGTATTACTCTGTTTACTTCTAAAA
TCTAGTGTTCTAATAACTTTGAAATATATTATTCTCTTTAACTTCTTTCC
GGATAGCTGATGAGTTTGAATTTGAACTCCACAGGACGCAAAGGTGTGAA
AGGAGCTCAGCCTGGTCCAGTC
View all "lga8" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lga9 TGAGCACAAATGGGAGATTCCCAACAAATGGCGGGAACAAATTTCTAATG
CGACAAAAATTGTGGAAGGAATTTAGGAATTTCGTCCGCTGCCCAATTTG
GTTTGTCAGTAGCATTATAGCCTTTGAATTTGCAGATGGCACATCACATC
AATTTTGCTTGCACCAAAATCTTGAATAGTTGGAGTAACTTCTTATCTTA
GACCAAGTTTATCAGTGATCCACCTCAGATGCATTTCCTTTATGGAAGGC
TAGCTTAACTGTTTGTAAAGTCCTTTCTGATTCTGTTTTCTGACCGCGTG
GTTCTGCAAAAAGAATAAACAGTGAATCATACGGTTACAGAGGGAACCAA
GCCACTGCAAAATCAAGAAAACCAAGTGAAATGATTACTAAACTTTGCTG
GATCTCGATAGTATAAGGATTGGTAGGAAAGATACAGCTACAAACATGCA
GGGCGCGGCCTTTGAAATATACTCTGTAATAATGGCTGACTATGAACTAA
AGAAAATAAATTTCTGAACTGGTGTTACTTATCTACAGCGTGTTTGAGGT
TACTCCTAACTGAACAAAGCTAAAATTTCCAAAAGCAT--GACGGTGGCA
TCCCCATTCAAAAATTAGTGGCACACAAGAAACTTGTCTCCGATTTGGAC
CAGTCGTCATCCTGGATTCCTGGTTGGTTAAAGAGCAAAGGAAACTAGAA
ACAAGAAATTGTCGTGTACCTTGAGAATAGGATGAATGCTTAACTTGCAG
AAATAAACTAGGCACGCTTGTTCAATATTCAGATGTTTGCTCCAGCTTCA
CTTCCACCCTTCTCAGAGGATGCAG
View all "lga9" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgb1 CAGGTCGTAGCCCGAGCCCCCATCCTCAGTTCCTCACCCTCTGCTTCATC
CTCAGTTCATGCTGTAGCTGTAGCTGTAGACGGCACTCTTATACATTCTT
TCTGTGGTATATACGGGCGAAAGACAGTCTTTCCGTGGTCTGACCCAATG
GTTTATGTGCAGTTTG-------AATGGTCATATATGTGTGCAAATTGTT
GTGCCAGGTCATATAGGTCAACCAAAAGCAGTTGTATAGCAATCTGCAGT
GCCAATTTTTCTAGTTCAGCATTCTGTTTTCCTTTCAGATCTCTTAGCGA
CAAGTCGACAACAACACATTCACATCCTTGTTTCCTAAAACAAAACATTT
TTTTTACATAAAATGGATGAAAATAGAGAGAAGGATCCATGTAACATTGT
GCCAATTTTGGGACCATGGGCCATACACCAAGATTAACGTTCTACGTTCC
CACCTCCCGCTATTGCATCTCTAGCCTCTAGGTTTTTTTTTTTTTTTTGA
CGAAATCTCTAGGTATTTTTTTGCCGCTTCATCTAATGCAGCAACAAAAA
TCACATTCGTCCGCAGGCTTGACACAGTGAGGCATAACGACTCAGCTGAA
TTGATTCCCGAAAGGTAATTCTATTTACTTCTACAGCCATGCTGTTCTTT
CGTGAATGAACATGGATGCTAATATTTGGTCAGTACGCCAGACTCGCGGT
GGTCACAGGAGGAAACAAAGGAGTTGGCCTCGAAGTATGCCGCCAGCTTG
CTCACAAGGGTGTGACAGTTATCCTTACAGCAAGGGATGAGAAACGAGGA
AAATATGCTGCTGAGACCCTTCGCCGTGAATCCGAACTCCCAAACATAAT
CTTCCATCAGCTTGATGTCAGAGATGATGATAGTGTCACCACATTGGCCC
GGTATGTCGAAAGAAGATATGGGAAGCTCGACATCTTGGTAAATCGTAGT
CTACTCCTATTTTTGAAGTAAATGACATCACTTTGTGTTTTTTAGTACAC
ACATAATTGATGATGTGATGGGTGATACAGGTGAACAATGCAGCTATTTC
AGGAATTGTAGCAGATGAGGAAGGCCTGAAAGCTCTCAACATTGATGCAG
AGACATGGGTACTTAGATTGTTCTTTAGCTTT
View all "lgb1" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgb101 AGTGAAATCGGCGTCAAAGAGGTTAGCTATTCTCGTGCCAGCCTCATATT
GAGTAATCCATAAGTTGTGTTTACTTGTTGCTTATTGTAGCGACTGCCAG
GCCCGTTAGAATTTAGATTAATATATTGCTTCTGTGTCTCTCCAGCTAAA
GGAAAGAGTGCATGAGCTACTGACCTCTCAGATGGCTCGGATCAAAGCTA
GCAAGGCGGAGCATGAAACACAGGAAATTAGGACTAGTGTTGTTTACTGA
AGTTTGACAATGAACACCCGAACATCCATGCTGGAAGTTTGTATAAACAT
TCCACTAATGTCGATGATGGTAACACGTTTCATCTGTTGTCATTTTACCC
ATCTGGAAAGGGTTGGTCAAATGCTAGTATGAATATGATTGCCCATTTTG
TTTCCCCCTACCATTGCCGTTATCCGTTCTTTAGTTGGGTATACCCTCCG
TCCCAAAAAGATTATCATTCTGGTTTTCTCCATGGCAGAAAGATTGTCAT
TTTTGTTTTCAAGAAGTCAATCGATCTCGAGTTTAATCAAAT-----ATG
C--AAAAAAAAACAAATATTTATGATGAGTAGTAAGTATCTTCAGATAAA
TAATGAAATGGTTTTCAAAATAAACCTATTCGGAGTGAATTGACCGTAGC
TTAGTTGGTTAGTTTTATTCTGGTGGAATT
View all "lgb101" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgb101 AGTGAAATCGGCGTCAAAGAGGTTAGCTATTCTCGTGCCAGCCTCATATT
GAGTAATCCATAAGTTGTGTTTACTTGTTGCTTATTGTAGCGACTGCCAG
GCCCGTTAGAATTTAGATTAATATATTGCTTCTGTGTCTCTCCAGCTAAA
GGAAAGAGTGCATGAGCTACTGACCTCTCAGATGGCTCGGATCAAAGCTA
GCAAGGCGGAGCATGAAACACAGGAAATTAGGACTAGTGTTGTTTACTGA
AGTTTGACAATGAACACCCGAACATCCATGCTGGAAGTTTGTATAAACAT
TCCACTAATGTCGATGATGGTAACACGTTTCATCTGTTGTCATTTTACCC
ATCTGGAAAGGGTTGGTCAAATGCTAGTATGAATATGATTGCCCATTTTG
TTTCCCCCTACCATTGCCGTTATCCGTTCATTAGTTGGGTATACCCTCCG
TCCCAAAAAGATTATCATTCTGGTTTTCTCCATGGCAGAAAGATTGTCAT
TTTTGTTTTCAAGAAGTCAATCGATCTCGAGTTTAATCAAAT-----ATG
C--AAAAAAAAACAAATATTTATGATGAGTAGTAAGTATCTTCAGATAAA
TAATGAAATGGTTTTCAAAATAAACCTATTCGGAGTGAATTGACCGTAGC
TTAGTTGGTTAGTTTTATTCTGGTGGAATT
View all "lgb101" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgb102 AAGCGCCACTTCACTTCGGACCTGACTACTTTGATAGTTTGATGAGTGCT
CAAGTAGGTCAATCTGTTTTTTGAGGCAAAGTAGGACAATCTGTTTTTTG
AGGCAAAGTAGGACAATCTGTTGTAATAGGAGCTGCTCTTCTTTTTCGGT
GTTAGGTGCTTGGTGCTAGGTGTTGGGTCGGTGGTAATCCTGGGATTACT
GTTGGCCGGTTGTGTACTTTAAACTCTACTTCCTCTCAATCTGTTGACAC
GGTCGCGAAAAAAGTAGGACAATCTGGACTTCCCTGTGCTTTGTAGTCCT
GCAGATTCTTAG--------------------------------------
--------------------------------------------------
TATTCTGAATATCTCAGTTTATTTAACCTTTGCAGCAGAAGATAGCAGTA
TGTTTGGTCCTAACTTAGATATACCCAATCTGAAAGCTTAAGTATTTTTT
GAAGAGAAGATGTCTGAAAACTTCAGTGACGACATGGGTTTCAGCTATAG
CAGTCTTACACGTCCTT---------------------------------
--------------------------------------------------
---AAAGACAGAGAAGATATTAATTCAATGTTTAGAAAGAATAGGTGCTA
TGGGCGCATCTTATCATTTATGTGGGGAGGGGAACATATATTGTGAAAAT
TGGAATATTCCCTTACTAATAAGTCTGTATGATTGTGACATATATGTAGT
AGTATATAAATACATCAAAGGGCAGCATGCATTTACATGTATTTAGCATG
CCAGCGCACTTCTGAAGAATGAAGTGTGATGAATGCTGAACAGATTGAGT
TCTGTTTCAGTTGTGATGAGT
View all "lgb102" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgb103 TCCAACAACACAGAGGTCGAGAAGCCAAAGCACTGGACAAACAATATACC
CAAGGTTCTCATGATAGGCGGTGCCGTCGCCCTGGCTTGCACCTTTGACG
GTGGATTGTTGACCAAGGCCGTCATATTCGGCACGGCGAGAAGGTTTGCA
GGGCCAGGAGGGCCAGGAAGGCGGTAGGTGGATGGAGCTGGTTACCGTAG
AGCAATGCCACCCTTGTCATGTAGCAAAGATATGCGTGGAAGTGCCCCAA
ACAATCTTTTTGTAGCAATACATTGCAGAGGACGGAATGCCGTGTCTAGA
TGTTCAGTGTAGACATCCTCATGCTGCAGATAAGGTGGTGTGCTCATATT
AGGTCAGTTGAGAAAATAGATCCTGCACATTCCAGAAAAGGAAATCGGCG
GAAAGATCCAGCGACACAGACCGGACATACATCTG-------TTGCTGCA
GTCGCCGCGGGTTAGAGCCAGCTGGTTAGGTTAGAACTATAGNATTATTT
TGAGGACAAGTGTGAAGAGTTGGTAAAGAGAACAGCCGTATGATGTAAGA
TGTACTAGGTTCATGTTACAAAATACACTGCTGTTTAGTAGTTAATAACA
AGAACAAGAATTCTGCCTTTTGTACCTATGTGGCATCTATTTGCTCGTCC
GGTCTTCCCTATGGATACTAGACGTTGACCTTTTGACAGTTGCTGC
View all "lgb103" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgb103 TCCAACAACACAGAGGTCGAGAAGCCAAAGCACTGGACAAACAATATACC
CAAGGTTCTCATGATAGGCGGTGCCGTCGCCCTGGCTTGCACCTTTGACG
GTGGATTGTTGACCAAGGCCGTCATATTCGGCACGGCGAGAAGGTTTGCA
GGGCCAGGAGGGCCAGGAAGGCGGTAGGTGGATGGAGCTGGTTACCGTAG
AGCAATGCCACCCTTGTCATGTAGCAAAGCTATGCGTGGAAGTGCCCCAA
ACAATCTTTTTGTAGCAATACATTGCAGAGGACGGAATGCCGTGTCTAGA
TGTTCAGTGTAGACATCCTCATGCTGCAGATAAGGTGGTGTGCTCATATT
AGGTCAGTTGAGAAAATAGATCCTGCACATTCCAGAAAAGGAAATCGGCG
GAAAGATCCAGCGACACAGACCGGACATACATCTG-------TTGCTGCA
GTCGCCGCGGGTTAGAGCCAGCTGGTTAGGTTAGAACTATAGNATTATTT
TGAGGACAAGTGTGAAGAGTTGGTAAAGAGAACAGCCGTATGATGTAAGA
TGTACTAGGTTCATGTTACAAAATACACTGCTGTTTAGTAGTTAATAACA
AGAACAAGAATTCTGCCTTTTGTACCTATGTGGCATCTATTTGCTCGTCC
GGTCTTCCCTATGGATACTAGACGTTGACCTTTTGACAGTTGCTGC
View all "lgb103" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgb105 GTAA--TGTAAT----ATGAGTCTATATACAATAACAAGTGAAATGAACA
ACTCCGGAGACGACG-TACATGTGGAACCCATAAGCAGATTTGTCATGGA
CCACTGGCCCGTTTTTCCTGAGTTTTGGACGATAATTTGATTGGTGAGAG
--GCAAATCATCGCACTGGCCTTGTCATCACACATATATA--GGCATGGA
CG---GCGGTACGA-GGAGAGAACGACACACTGTACTATCTTGCAGGAAC
TTGTTTTATTTTTTTT---ATTTTGTTTTAGTTTTCGTTAATAAAATGGC
TGAACGT----------------AATAATTTCCTGATCAACTCTATTTTG
CTCATGG--ATGGTGTGCTCGATCATGGACGTACGCACGCACGCAGTGGC
CAGGAGCATACTGCGAGCAGACCAACGCTGGATGCTGCAAGCCGACGACC
GGCGTCTCGCCGGCGCGCGACTTCTACATAACGGGCCTCACCGTCTACAA
CGCGACCACCAACGCTGCACTGACGGAGTGCAGCAATCAAGCTCCTTACA
ACCCTAACCTGGTACGTCCGTAGACTCTCGCTCCAGCTCGATCGATCGCC
--ATATATATATATGCACATCTAGTGTT----GTCGTAGGTGTGACAAG-
------ACCTTTAATTTGTGTGTGTGT----GTT-GCAATGTCCATCTCG
ACAGATTACCGGCATCGGCCTGGAGCAGTACTGGATCAACATCAA
View all "lgb105" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgb107 ATGGTTCCTCTTTAAGTGCAGTTTTTTCTACGTACATATATATGCAGTAT
GCGCCCCTGCTGAGTGGCATATGCATGTGTGTGTGCATACACATACACAT
TGCGCTTATACATATATTCTTGTGCAAATGATACATGTTCAGAACGCGGA
GCCTTGCCGATCGAGCAGCTCGCAGGTGTCAAACCACGAGCTGAGCAGCC
CGAGCCTGGAGTTCACGCTTGGGAGACCGGACTGGCAGGGCACGGATCAT
GACTAGCTACTGGCTATTAGCTAGCCATGTTTCGTGAAGCAGCTCACAGA
ACCTAGCTAGAAGGCTAATTTCTTCATTGAGGGTTATAGTAGCAGCAGTA
CTGATATCAGGAATGCCTGATGATCTCCAACTCGTAGGCGACAACGACAG
GTCTTCGCCTGCGAAGATGAACAATCAACCAACAAGTACAGCAGCAGCAG
CAGCAACCGCAGCATCTCGTCTCCACCGGTGTGGTCTTGTGGAGATGGGA
GTACGTGCCGATGGAGCACCGTACCGGGAAGAAACTAAAGACTTACTGGG
TCTCTCTCTC------AGAGAGAGAGAGAGAGAGAGAAAGAGAGTTGA
View all "lgb107" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgb11 GACTATAAGAGATTCCA---GGGACAGAAACTAGTTTTGTA---TTAAAA
TTCATA--TGATGGTTGCTGCAGGAGTTACTACAAATGTGGCCGCCGGCC
GGGCTGCCCCGCGAAGAAGCACGTGCAGCAATGCGACGCGGATCCGTCCA
AGCTGGAGGTCACCTACTTGGAGGCACACACGTGCGATGATCCACCACCG
TCGTCGTCCCATG-------------------------------------
--------------------------------CAGCTCAGTGCTACGGCG
GCGGCCGACCGTCGCCGCCGCCGCTGCCGCC---GTACCAGGTGCCGTAC
GCCGCGACGACGCTCGGCTCCAACGTCCTGACGCTGACGGCCACCGGTGT
TCTTCTGCCTAGTGCAAGCTACGACCCTGTTCCGGATGTCACGGACTGCA
CGCCGTCGTTGGAGCAGGAGCAAGACCACGATCTGCTTCACATACCTTCG
CCGGCTTGTTCACAGTCAGAGCTGCTGCCGATGGAGGCTGCCAAGCTTTC
ACCGCACGCGCACGGGCTGCCTCTGTCGTTGGAGCACACGCTGGATTGCG
ACTTTGCTGTACCCGAGCTTTAATTAGCGTTCTTGATGTTAAAGAGTGTG
ATCGACCCTTTCACGGTAGCAGATTACATACAACAGCATCGATATTCTTG
TTTTCTGTACAGCTATTACTGTAATGCAATGCGATTAGAGTAG
View all "lgb11" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgb110 TTTCCCCATCTGCTGCTGATCCTGGTGCTACTCTTGATCCTGGAGAATGT
CCGAGCGCAACCCAACAGACCACTTCTGATCAACTGCGGCTCGGGTTCAA
GCGCCGATGTCGATGGCAGGACATGGGTGGGGGACGCCCGTCCTGACGGT
ACCGACTTCACGGTCACATTGCCCGGAGTCATTGTCCCAGCTCCAAAACC
TGACGGAGGGGGAGGAGATGCGTACGGGGACCTCTACAGGACTGCTCGCG
TCTTCAACGCGTCGTCCACCTACAACCTCAGCGTCGCCGCCGGGAGCTAC
TTCCTCCGGCTCCATTTCAGCCAGCTCTTCAGCAACCTCAGCAGTGGCAA
GGAGTCGGTCTTCGATGTCACGGCCAATGGCCTGAGGCTGCTCTCCAAGT
TCAGTGTCCCCGGGGAAATCTTCTGGAGGAACGCGAGGAGCAACTCCACC
AGCGATGTCATTGTGAAGGAGTACCTGCTCAATGTCACCTCTGCAAAGCT
GGAGGTCGAATTTGCGCCGGATGCCGGGTCGTTTGCCTTCATCAATGCCA
TGGAGGTTGTGCCTGTGCCCGGCAACTCGATCTTCGATTCGGTCAACAAG
GTGGGTGGTGTTGGGGTGAAGGGCCCTTTCAACCTTGGAGAGAGTGGGAT
TGAGACCATGTATAGGGTGTGTGTGGGAGGTGGCAAGATTGAGAGGAAGG
AGGACCCGCGCCTCTGGAGGAAGTGGGATTCAGATGAGCATTACATATTC
GCTATGAATGCTGCTCGCAG
View all "lgb110" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgb12 GGTATCCGCTTCGTTCTCTTCTCCAGGCCCCAACGTGGTCACCCCTGATA
TCTTGAAGGTGTGTGCCTGCCTGATGCTAATCGTCATTGCAACGTTCATC
GCACAGTTAAAAATGTCTTGCGGAAAT-TAATTTGTACAACGTTCAAACT
AATGCAGCCTGATCTGTCTGCACCGGGGATTGACATCATAGCCTCATGGT
CGCTGCTGTCATCGCCTACGGGCATCGCCAACGACACCAGGAAGGTTCAG
TACAACATCATCTCCGGCACATCCATGGCGTGCCCACACGCGAGCGGTGC
CGCCGCCTACGTCAAGTCATTCCACCGTGACTGGTCGCCGGCGATGATCA
TGTCTGCTCTCATCACCACCGGTATGTTCCATTATATCCCATGGCATCAA
AGATCGATCCATTCCGAGTTCTTTGTCAATACATCGCAACGCATGGTGCT
CGTCGTCATGCATATGCAGCCACTCCGATGGACACACCGGCCAACGCCAA
CACCAGCGTGCTCAAGTACGGCGCCGGGCAGCTCAACCCGGCAATGGCGC
ACGACCCAGGGCTCGTGTACGACGCATCGGAGAGCGACTACGTGGCTATG
CTGTGCGCGCAGGGGTACAACGCCACGCAGCTC
View all "lgb12" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgb14 CGATCATCTTCTTCATTCGTCTCAATATATATATTCTCTGATCGATCGAT
CGATCAGGTCTCCATCCCTCGATCAGCTCTAGCTAGCTACCTTCTTGCTC
GATCGATCCATGATCACCGCAGCCGGCCACCGCGAGGCAACAAAAATCTA
GCCGCCGGTCGGCGATCGACAGGCCGCCCGCCGGCTGCGACGACGACGGA
CTACGTGGTCGC---CCGGATGCAAGCAACAGGCCACACTA---GTCCTT
ACAATGCCGCCGTGCCGCCTGTTGCTCACTCCATCGCCATCGCCGCCGAC
CACCGTCCTCCACCAGTGGTGAGTATTTCAAATTTTCAATTCAGTTATAT
TATAGCTATAGCTATTATGCCCATTAATTAATTTCATCAGATTATTA---
-GGACCACGCACGCACTATATGTTTATTTGCATTTTTGGAAAGAGGAAAC
ATGACAGCATTGCACTACCTCTACT---AGCCTGAGAGCCTGACTAGCTA
----CCATGCTGAGAGACTTGCGTTTGATTGGTTT---AACCGACTTCTC
View all "lgb14" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgb15 GGCGGCACCCACTGGGTCCCCGTCGGACCCACCAAGGGCGGAAGGCTCTT
CGTCAACATCGGGGACCAGATCGAGGTGCTCAGCGGCGGCGCCTACCGGA
GCATCGTGCACCGCGTCGCGGCCGGGGACCAGGGCCGCCGCCTGTCCGTA
GCCACGTTCTACAACCCAGGCCCCGACGCCGTGGTGGCGCCGGCGGCCAG
CATCCGGCGGGAGGACGCCGACGCG------GCGGCGTACCCCGGACCCT
ACAGGTTCGGGGACTACCTCGAGTACTACCAGGGCACCAAGTTCGGCGAC
AAGGACGCCAGGTTCCAGGCCGTCAAGAAGCTGCTCGGTTAAGCGATCGA
TCCAGCACCAGCAGCACCAGCTGCATTGCCAGAGGCCAGCAGGCAGCTAG
CTTATTAGTTCGTGGATTATGCGTTGCGTT-----GCGTTTCGATTTCGA
GATTGCTTCTTGTTGATCCATTGTCGATCTGCATAGTATATGCACTGGGG
TCGCGTGTTTAATTAAGTTTAGTACTATTTAGCAAATCTTTTACGTAGTA
ATTACTGGTACTACGT--TCGTATTCAGCTGTGGTGTTGACTATACAATG
TTGCGGCTTAATTAATTGCGCATCCCGTTTGGTGGACTTGCAGTCTTGCA
CATGC
View all "lgb15" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgb18 ATTCACCATGGCTCTGTATTATACTGCTTCAAAATGGTAGCATTCTTCTG
CCTCGCTACGTATCCTACACTGTGGTCACGTCATATGTTACATTAAATAA
GCACATCCATAAATCACAGTAGGGCTCTTCTTTTCTCTCCTCATTGGAGA
CTCATGCATTACATGTTTCTCTATTCATATTCCTTCTGCAAGACCTCATC
TGAGAGACATAAACTCCAAGCTGCTCCGTCTTCTGTGGTTCATCAACATC
TAGTTTCAGCCTACTAGTAGTGTTTAGCTTTTGATGTAGGGCTCCTCCCC
GGCTCCAGCTCCGGCTTCTCTAGACGAGCCCTACCAAAAGTTTTGTAGGA
GGAGCCAAGTAAAAAACAAAGGAGCCGGAAGAGCCCCTCAGGAGGAGCCC
TGCCAAACACCCCTGTAGTCTCAAAGCAGCACCAACTCCAAGTTTGACCA
TGTTGATGGATCTCCCAAGTTGCCAACAAAGTGGGGGTAAAGTCCAACTT
GGAGCAAGGGACCTGCAC
View all "lgb18" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgb4 AGATATGATGACTGGAGGTGTGGTTTTTGTCAGTGTACAGTGCTTACAAC
CATACAAGCGATCATCAGATCATGGGAGTTCTCAAAAGGAAGATACAAAT
AGGATATTGCAATCTTAGGACACGAG---TCTTGAGGATAGTGAAGCATA
TTGGTGTGTGCATCTGATAGCAGCAAAGATCTCTCGAGTGCACTGGATCT
TTGCTTTTGAATCCTAGTATTCGCTAGCTGGGAGCATCCAACACTCAA--
--CTCTCTCTCTCTCCCAATCCCAACTTCCCAAGTGCTCTTGGAGCCGAT
CAGCCAAAAACTGCGTAAAGGTACGTCTTATTGTTTCAA---TCAATCAG
TAACATCAAAAGTTTACCCAATCACACAATACTGTGAAATGCGCACGAAA
ACCATTTGAGCTCCCCTAA--CGCTTTG-TTTGTTTCATACTACTGCGTA
ATTGTGCTCGGGCCTAGCTGCGCGTTGCTAGGAGCTACTACTTCATTATT
ATCCTCGCCTTTCTTCTTGCAACAAACACATGTCCACAACTCGCAGTGTC
CGTGATGGTAGCCCTTTCCATCGGCGCCCTGGCACTTGTTCACACATCTC
TTGTTCTTCACACAATAGTTGTCCCACAGTCGGAAGCACTTCCATTTTGT
CTTGGTGTCTCCAGGATCGTCGTCTCCCTCGCGCAGTGGTGACAGCTCTC
TTGCTGAATAGATCAAGATCACAAAAATCAATCAGCTCAATCATTTCACA
TACCAGTTATTTGATT
View all "lgb4" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgb7 CTGATAGCATGTTAGCCGTTACATTTCACGCCCATTTCTATCTCCTAGCA
AAAAACAGAAAAAGTCATTCTCACCTCCTTAGGTGAGTGATGTAGACCTT
TAGGTGATCGGTGCGAATAGTAAACTTCTGCCAATTTTATCAAGCCTGTT
CCTCTGGGTTGCACTTAGCATTCACTTGAATATGCTGGGCATATCTGTTC
TTGCTGTCTCTACTGAAAGCACCCTTGACATTTAGGAATTGGGATTAATT
TATGCTGCTTTAGCAGCGCAGCAGTGTTGGGCCTATCAGATTCATTACTT
ATTACCTTTTAGTTCAAAATTTTGTGTATCTTTTATCACAGTGTACAGTA
AAAGTAACCGAGTCATATTGCTTATTTTCTAGCAAGTGGGTCATGATGAA
CCAAAATACACGGAGACTTCAGCGAGTCAGTGATGACGTAAGGGATGAGG
TGTTTATACATTGTCCAAAGACTCCAAGGTAAAGCGACTCACTTTTGTTC
TCAACATTCTGCATAGACATGCACTCTTGTTATTTCCATACATC-CATGT
GTCAAAAGTGCCCAAGTAGCTCTCTGCCCTTTTGGAACCCATGACTATTT
GAACTTTGAAGTTTTACACTCAGTTGGGTCATTTAA
View all "lgb7" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgb9 TGGCTTGCAATGAATAAGTTTTCTGGATTCATCTATGTGCACTTTTAATT
TAGGATCTTCATAACTGCTTATGGTGCTTGATTTGTTTTTTTTTACTAGA
GTCAAAGTATGCTATCAAGATTATACCACTCTTTATCACAATTGATCCTC
AACGTGATTCACCTTCTCAGCTTAAGGCATACCTTAGTGGTAAGATATTC
TGCTATTGGGGTCAGAAACATTGAAATTTTAGGCTATGCTGCAAGTGATG
ATTCGCCTCGTTTTAACTGCAGAGTTTGACCCAAGAATAGTAGGACTAAC
AGGCCCCATCAGTGCAGTAAGACAGATTGCTCAGGAGTACCGTGTTTTCT
TTAAAAGAGTAGAGGAAGTTGGTCAGGACTATCTTGTAGAGAGCTCTCAC
AATATGTAAGTGCATGTTGTGCACCTTGCCATGTTGATGAATGTTTTCAG
ACATTGACCATCTGAAGTTACAGGTACTTGCTAGATCCATGCTTGGAGAC
AGTTAGGTGCTTTGGAACTGAGTATGAAGCATCAGACCTTGCTGAGGCGA
TAACAACA
View all "lgb9" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgc1 TAATATGATTGTTATAGAGTTTATATATACTAAAATACTAGATTCAACAA
ATATGTTATCGACTTCACGTGAAACTTAAGGTGCCTGCCCTCACATCAAA
ATTTGAGTATTGTTTGCCTAAGCGAAGTTATTTTTTTCTTGGGCATATTT
CTCCATGGTTGCTTTTGTTGATGAGCAGAAGTGAGCATGTTTTGGCTATC
TAAACTCTGGAGTCTTGTCGTGCAGTTATATGCTTGAGTTTTTGGGCTGA
GGTGCACTACAACTCGATATATCCGGAAGGAGGTATTAGATGTCACCATT
TAGTATGTTGACCATGTTTGTTGAGTGTTTGATTTCATCATTATTATCTG
CTGCAGAGTTGCCGGTTTTGGAGAACAAAAAGAAAAGCTGGTGGCCCTTC
TAGCTAGCATTCCCAGGACGGGACAAGGAAGAAGATTAGAGCAGCTAGGG
ATCCCGAGCAGCTAACAGATAGGAGCCTTTCTGTTGGGCTATGTGACTAA
CTCATGGCGACGCGGAGGCCATGGGCAGTTGCGGCTTGCGCCTTTGACGG
CACTGCATTACCATTGTCATTGCCATAGGGGAGACATGTGCAGTACTGTA
CGTAGTAGTAGATGATACTCACTATCCCATTTGTACAGAGAGAACGAGGG
AAGAGCGAGACAGATAATCAGGCCATTAGCATAGTAATAGTAGTAATAAT
AATGTAATACAGGAGGGAGGAGAGGGTCATTCATTCATTGATTCATT
View all "lgc1" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgc1 TAATATGATTGTTATAGAGTTTATATATACTAAAATACTAGATTCAACAA
ATATGTTATCGACTTCACGTGAAACTTAAGGTGCCTGCCCTCACATCAAA
ATTTGAGTATTGTTTGCCTAAGCGAAGTTATTTTTTTCTTGGGCATATTT
CTCCATGGTTGCTTTTGTTGATGAGCAGAAGTGAGCATGTTTTGGCTATC
TAAACTCTGGAGTCTTGTCGTGCAGTTATATGCTTGAGTTTTTGGGCTGA
GGTGCACTACAACTCGATATATCCGGAAGGAGGTATTAGATGTCACCATT
TAGTATGTTGACCATGTTTGTTGAGTGTTTGATTTCATCATTATTATCTG
CTGCAGAGTTGCCGGTTTTGGAGAACAAAAAGAAAAGCTGGTGGCCCTTC
TAGCTAGCATTCCCAGGACGGGACAAGGAAAAAGATTAGAGCAGCTAGGG
ATCCCGAGCAGCTAACAGATAGGAGCCTTTCTGTTGGGCTATGTGACTAA
CTCATGGCGACGCGGAGGCCATGGGCAGTTGCGGCTTGCGCCTTTGACGG
CACTGCATTACCATTGTCATTGCCATAGGGGAGACATGTGCAGTACTGTA
CGTAGTAGTAGATGATACTCACTATCCCATTTGTACAGAGAGAACGAGGG
AAGAGCGAGACAGATAATCAGGCCATTAGCATAGTAATAGTAGTAATAAT
AATGTAATACAGGAGGGAGGAGAGGGTCATTCATTCATTGATTCATT
View all "lgc1" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgc101 TGGAAAGCACATTCTTCATGCATATACTCCAGGGACGGAACCTTTCAGTT
TGTGGGAGGGATTGGACAGGAAAAGTGCAGAATATCGAAGATTGAAGGAA
GAACGTTCTGAGGTACGTACATGGGCTGGCAATTTTGATTCTTTGCCACT
ATTACTATTAGTAGTACCTAGTAGCAAATAAATGCATAATTTAGATATAT
TCTTAGAAGTCTCATCTGTGCACCCTTAATGGCCCAGTTCTTAAATGCAC
GTGCTCATTTGCGTTGTCTAAGCAAGATCTGTTATCAAAAGAGATGGAAT
AGTCAAAAGAGAGAAATGCCCCCACAGTTGGCACAGAAATCATCAAAATG
ACTCTCGTTTTTCAAAAAGAAGACCACTATCGAGTGTCCGTAAGAAGTAA
TAACTTTGTTGTCTTGACTGTGACTGACATTCCCATGCAAACTTTTCAGG
TGATGTGGAAAGCTGTGGAGCTTGCTCTTGGCCCAAAATTTAGCCGTGAA
AGATGCGACGTGAAATTGGTCGGGACACCACTAACGCACAAGAGATTTCT
CAGAAGGAATAGGGGAACCTATGGTCCAGCCATAAAAGCTGGAGAAGCCA
CTTTCCCTGGGCAAGCAACACCAATCCCCCAGCTCTTCTGCTGCGGTGAC
TCGACTTTTCCAGGGATTGGAGTGCCGGCGGTCGCGGCCAGCG
View all "lgc101" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgc102 TGATACAGCTGGATCTAATCGTCTATATGCTACTGCTTATGCATGACAAT
TCTTCTTGCCATGAGTCACACAAGCTTTCAGTATAATGGTTTTCTGCTAT
CACCCTCCTGATTGATGGCATTTGCACAGCCCTATTTCCCTCTGTCCTTT
AGTAGGTAGCATCCGGATGTGGTGTTTCAGTTTGTGCGTAACTCAATTGT
TTAAGATATAATAACATTAGTATTGTTGCTGCTGCAGTTCACAAATATTG
TTGTTCAGTTTTGTTTGCACCGGTATCTGTTATTTATCGGATTCCTGACT
GAAAGGCACGCTTCATTCTACAATTCTAGTTGTCCCCCACAGCACCTTAG
CCCACATACTGGAAATGAGCACATATTTCCAGTTTACTTTAACAAGTTGC
AAACAAATTCTCGTGAACTCCACGTGGCGGAAAATATTGTTTCTTGATTG
TCACCTTTACACTTGAAAATATACCTTTTTGCCCTTGTCTTGGGATTGAT
TCTGTAGTTCTGGTCTAACACCTCTAGCTTGGTCATTTTATTATCTTTGT
GTTCTGACACTGAACAAAAAATGTCTGGCTTCTTTGGTCAGAGAGGCCGT
AAAATCAGGTTGTCTGTCTTCTTCATTATCCAAACACATTGATAAGAACA
CATCAATACTATAGTCCCTCCTGATGGTACTGTATCATGGAAAATGCTTC
ATTTGGTTGAATGTCTCCTGTATGTGTTATTGCTGGTACTGTGTATTGAA
TTTAAAGACGGTTGTTTTGTCATCTAGGAAATCACTTCAGCCTCCAGAAT
GGTGTCTACACCCA
View all "lgc102" genotypes
[ Download ]