grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "Purdue No. 49018" from the experiment "Hamblin, Casa, et al. (2006) Challenges of Detecting Directional Selection After a Bottleneck: Lessons From Sorghum bicolor. Genetics 173: 953-964.".

E.g., Germplasm L-WA58, Marker/locus pSB0080.

Items 26 to 50 of 216.       Previous | of 9 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
Purdue No. 49018   bicolor, NULL Cameroon   lgf19 CGATATGTTCATCGTTAAGAAGAAAAGACAAGATCGGGCAAGGAGCAGCA
TTGGGTCCCCCTCCAGTTCAGGCCGAGCTGGACCTCTCTCACCAGCCAAC
CCTGGGCGGCCAGGCCCAGTCCCCTCACCCAGAGGTGCCAGGACGCCCTT
CCAAAGGGATCCACACCCATCTCAGCAGTCGATGCATTCCGCTGGATGGG
GCGCGCATTCAGATCAAGGAGGAAGTTCGTCAGCACCCGGCATTGGAGAC
ATCCAGTGGGCAAAGCCTGCCAAGAGACTGAGGACCGACAGCGGCAAGAG
GCGGCCGAGCCTAATGTGAGGATTCTTTGCATCGCGGTGTGCATTCTCTG
GCAACCTTGATTTGCCTGGCCTATGAAATGTGGGCTGCACTGGTGGGGGC
TTGTTCGTGTAATTTTGGCACACAGCTGAGTTCGTTCTTGCATATATGAG
CACCTACATGCTGGGGCTTTTGTTGTTGTGGACATGAAGAAATGTGGAAG
GGTAGTGTTATTGTTCCTGTATGTTATTAGCTTCATAAATGTGTAAAGGG
AACTCTTATGGT
View all "lgf19" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgc107 CATGTGAGTTCTTGCTATGCCNAAACACGTGACGTGACCTTTTGTCTGTT
CCTAGTAAGTTGGTCGATCGATCGATCATTCAGGGCTGATGAGCTCTGTT
GATACTTGCTACTGCTGATAAGTGATAATCATCCGTGTGGCCATAC----
---CATTCAAATCATTGACAGGTGGGCTGAGATATGTAATGATTGGGTAC
GGTTCGATCCATATGCTCCCAACGCATCTGCATTCCTCCGTACTCAGAAC
TGAACAGCTTCTTTAGCCATGCAACTAGTGCAACTTCTGACAATCAAACA
GAAAATTACGGCTTCTATATGATGCAAGAAACCTTTACTCATGGGTCCAC
GAGATTTTGTTTAGGCATTACCTATTTATTGGTTTGGTTGAGACTTGAGA
CTTGAGAGGCTTGTAACCCATCAGATGTACCATTGCTATGTCATGTAATC
TTAAGTGAAGTAGGTCTAATATATTTAACAATGAAATAATGGATAGATGA
TTGTGCCCACATATGTGCTTGTGTGCACACAGCATGTTCTGCTTCTAATC
ATCGAGTTTTCTGGTGCTTTATTTCCGTACCTTCTTGATACAATTATATC
TAACGACAAATGGTTGTGTTATCATGTTTTCTTGATACAATTATCTCAAG
GACAAATGGTTGCCTTATCATGTTTGATCATTGACTTGCAGATATACAGC
ATATTCTGAGCTTCTGCCTATTCTAGCTGCTGGG
View all "lgc107" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   pSB0243 GCTGGCCGCCTGTTGAATTGCTCCCTTGTTGTTTGTCTCCGTGCTGTGCC
TGTCGCTGTCGTCAAAGATTACAACTTTCTGGAGGAGGTGAAGCAGGCCC
ACGAGTCCGCGCACAGGCTCGTCGGCGGCTTCGGCGGCAACTTTGGGGGA
CGGGGATCCGGCGGCGCCAAGCTGCCCGGATGGCTCTTGTACCTCAGCAA
GGCGGCGAAACGCCGGGGCGTTAGTCTCTGCTTCCTCCCCAGGGGCATGG
CCAGGAGAGAGCAGAACCGCTCGCGCCACAACTACAGGTGCTTTGTCTTG
TT-GATTCAGTTTTGACGTGCCATCAGTGTGATGCATTGCTGCTGGGGAT
GTACTACAGGTGCTTTGTCTTGTTGATTCAGTTTTGACGTGCCATCAGTG
TGATGCATTGCTGCTGGGGATGTTCAGCAGGCTTGCTTTCCAATTGTTGA
ATGACATAGCATGTGTGGTTCCTTTCTCATTATTATTTGAAAGGATCTTG
GTTCAGTTTAAATTTTTGGTGCAACCCTA
View all "pSB0243" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgg2 CTCTGAAGTTTTACATGCTTTCGATGTTGTTCCCTAATGTTGGTTGACAA
ACTTCTTTGAGGAAGTTTTTATCAAAAATTTCTTTTCTAAGTTTGTCTCT
AGAGTCCTGTCAATAGTTCGTTTCTAAAATTGTGAATAGTCCGTTTCTAA
CATTCTGCCCTCGTTTTGGCGTCTTCAGGTGGTGCCCTCAATTGCCATTG
CATTTGTCACTTACGAGGTTGTGAAGGATGTGCTAGGAGTAGAGATGAGG
ATATCAGACTGAAGAAGCGGGGGTAGTGCTGGTCGTTATCAACTGCTATT
TTTGTAGGTTTTGGGGAGTTTCTGTTTTTGTAGGCAGGGCGAGTAGGAGG
ATATGACTGCGGCTACATTTCAGCATCAGGCCCTCCCAGCCCATGTTGAT
ATATCCTGCTACTGGCTTCAGGTCCTAGAATTGTTGCTGGATCGCGCGAA
AAGTAATAAGTTGGCTGTAAAGCTTTAAGCATTTGCCTAACTCATAAAAA
AATCTGTCCCTTGTTGATGTACCGAGATTGAACTTAAAAGCGGTATTGCG
TGCTGCTAATAGTTGATTCTAATGA
View all "lgg2" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lga2 TTTTTTGGCAGTGTCATGTTTTGTAAGGGCAACTACGTGTGTGCTCAAAA
GAACCCAAGATGTACACGCAAAGGAGATGTAGTCTGCTGATGCAGCATTG
TAAAGTCCACACTCTGCAGGTTAACCCTTTTTTGGGGCCGTCAAGTGTTA
GCGCCCTATGTATGTTATCAACCCTGCAGAGAGGTTGCAAATACTGAACC
ACTCTCACAAACTTGCACCTGTCGAGATCATTTTGTAATCTACTACATCT
TTGTTCAGAATTGTTTTTTTTTT------CACCCGTTGTGTAGTTTACCC
TGAAGGGACTTTCGTTTCTCTTGAAGTACGTGCTTCGGCACGATCGTGAA
TAAAACTGTTAGCATCAGTCAGCTGCCTGTTGAGCAGTAAGAGAAAATAC
AAAGAGGTATGCAAGCCTAGGCTTACATGAGCGCAACACCATTTTACATT
CAATGTGCTTCGTCTTCAACAGATGGTTGGTCTGAAAATCCTTGCATTTC
GCTCTTTCATGGTATCCAACTGATGCTAACTGTCGGTCTGAATCGGGCCT
CTGCTCTGATT-CTCAACTGGGGCAGCTCAGGTCAGGGAAACTGGAGATG
GCGTCAGGTGCTCAAAAGCGAAATGTGTCACGCGCGTCTATGAAGAAGCA
CATTGGATCAAAGAGCTATTTATTTATGCCAAGCAAGCGAGATGATTCAG
ATGTATCCAAATGGCCGGTCCGAAATGCAGAAGATGATGAGTAAATATGG
TTTGGGAAACCACTTCTATGCCAAGCAT
View all "lga2" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgf106 CTGCAGGCAGCTGCGCTCTGGAGTGTGCAGAGTTACAGTTCTGTGCGGAG
GACATGAGTTCTGCAGGATTACATGGGCAGCCTGGCTCGGCAATCGTTCT
GGACGCCGTGCCAGTAAAGGATCTTTCCTTTCAGAAGCTTCAGTATGGCA
TGAATCAGGTAGTCGATTTACAGTTACTGGCACAGCATTTCCTAACCATT
CTCGTGATGCTGTCTCCCTTTTCATCATGTGAAAGTTAGAGAATTTTTAT
GTGCCATGCAGCTCGGTCTGGAGACCAAAGGACGCATAAGGGATTCGCTA
TACCGGTTGGCCAACAGGCTTGAACAAAAGCATCGTGTTGCTTGTTCAAG
TGAAGGATTGGGATCATCGAGTTCAGATAGGTTGCCATGCATGTTCTGAT
ATAGATTCGTTAATTCGTCGAATCACTGTACCTTGATCCACCATTTCAGG
TCCTGAATATGTTTATAATGTTACG--TGGCAGGTTCGAATCAGGCAGAT
GGACCGAGACGCAGACGAACCCCATGGA
View all "lgf106" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgi109 TTGTATCCAGCATATTTCTCTGTACTTTGTGTTAAGTTTTTATGCTTGCT
GACACTTAGATTTTTGTTCTGACATGTCAAATGTGG---AACACTGATAT
TTCTTAATTTCTATTTATGAAGCCCTACAGATGTTGATGCTCTTTTCCTT
GGACATGCTCTTTTTGTCCTCAGTGTGTTGCCTGTAAGTTTCCCTCTATA
CTTTGTTGTGTACCCTAATGTCAGACACTGACTCATCTAGTTGCATAGGA
AAATTGATCGAAGCACAGATGCCTGATTGCACTTGCACGTTCTCTTGAAA
GCGCTGGTTCCCATCTTGAATGCTTCTGATGTTAGTAGTAACTATCTAGT
TGCATAGAAAATTAATTGAAGTACAGATGGCTGGTTGAACTTGCATTCTC
CTGAAAGTGCAGGTTCACATCTTGAATGCATCTGATGTTAGTAGTATTGG
GATTGGGTGTTTTTTCTATGCTATTAAGAATTTCCTAGCACTAAGCCTAA
ACCTATCAAGCAAATGATCCAAAGCATCCTCAGATTATGTTTTATATAGT
TAGTTTCAGGGCATGTTCTGATCTTACTTCTGCCTTAGGATACATCTGTG
CTGAGGGGCACTTTGCAGAAGCATGACAACTTGGTGAACTTTGCTGAGCA
TCACAAGGTCCAATTGCTGGAAACCTCATCATCGTCATCATCAGGATTAG
GATCATCACCTAGTCCATCATCATC
View all "lgi109" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgi109 TTGTATCCAGCATATTTCTCTGTACTTTGTGTTAAGTTTTTATGCTTGCT
GACACTTAGATTTTTGTTCTGACATGTCAAATGTGG---AACACTGATAT
TTCTTAATTTCTATTTATGAAGCCCTACAGATGTTGATGCTCTTTTCCTT
GGACATGCTCTTTTTGTCCTCAGTGTGTTGCCTGTAAGTTTCCCTCTATA
CTTTGTTGTGTACCCTAATGTCAGACACTGACTCATCTAGTTGCATAGGA
AAATTGATCGAAGCACAGATGCCTGATTGCACTTGCACGTTCTCTTGAAA
GCGCTGGTTCCCATCTTGAATGCTTCTGATGTTAGTAGTAACTATCTAGT
TGCATAGAAAATTAATTGAAGTACAGATGGCTGGTTGAACTTGCATTCTC
CTGAAAGTGCAGGTTCACATCTTGAATGCATCTGATGTTAGTAGTATTGG
GATTGGGTGTTTTTTCTATGCTATTAAGCATTTCCTAGCACTAAGCCTAA
ACCTATCAAGCAAATGATCCAAAGCATCCTCAGATTATGTTTTATATAGT
TAGTTTCAGGGCATGTTCTGATCTTACTTCTGCCTTAGGATACATCTGTG
CTGAGGGGCACTTTGCAGAAGCATGACAACTTGGTGAACTTTGCTGAGCA
TCACAAGGTCCAATTGCTGGAAACCTCATCATCGTCATCATCAGGATTAG
GATCATCACCTAGTCCATCATCATC
View all "lgi109" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgc101 TGGAAAGCACATTCTTCATGCATATACTCCAGGGACGGAACCTTTCAGTT
TGTGGGAGGGATTGGACAGGAAAAGTGCAGAATATCGAAGATTGAAGGAA
GAACGTTCTGAGGTACGTACATGGGCTGGCAATTTTGATTCTTTGCCACT
ATTACTATTAGTAGTACCTAGTAGCAAATAAATGCATAATTTAGATATAT
TCTTAGAAGTCTCATCTGTGCACCCTTAATGGCCCAGTTCTTAAATGCAC
GTGCTCATTTGCGTTGTCTAAGCAAGATCTGTTATCAAAAGAGATGGAAT
AGTCAAAAGAGAGAAATGCCCCCACAGTTGGCACAGAAATCATCAAAATG
ACTCTCGTTTTTCAAAAAGAAGACCACTATCGAGTGTCCGTAAGAAGTAA
TAACTTTGTTGTCTTGACTGTGACTGACATTCCCATGCAAACTTTTCAGG
TGATGTGGAAAGCTGTGGAGCTTGCTCTTGGCCCAAAATTTAGCCGTGAA
AGATGCGACGTGAAATTGGTCGGGACACCACTAACGCACAAGAGATTTCT
CAGAAGGAATAGGGGAACCTATGGTCCAGCCATAAAAGCTGGAGAAGCCA
CTTTCCCTGGGCAAGCAACACCAATCCCCCAGCTCTTCTGCTGCGGTGAC
TCGACTTTTCCAGGGATTGGAGTGCCGGCGGTCGCGGCCAGCG
View all "lgc101" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgf103 AGCGCAGCCGCAAAGAATGTAAACTTTCTTCTTCCTCCCCAGACGCACAG
CAGTAACAACAACTATAC------TCGTGGCTAGCTTGCTGTCTGCGTGT
CTTGTGATTTGACCCATCACTTTACAATGTCAGCATGGACACAGCGACAG
CATGTGTCTGGTGCTGGCTGCTTGTGCCTGGGTGTGGGCTGAGGCTCTGT
TTGCTGCCCCACCGGCACAGCCAAAGCATACA------------------
----------GATAGTGTTCGTTTTCAGTATTTGCTTCGAAGTACTCTAT
ACTAATGCGATCCTGATTTTGCATTGTCTTCCTCTCATTTGTGTTTGTTA
TCAGTGGGCCCATTTCCCACACATCCACTTCGGCCTCATGCCGGACCAGG
GCCTCAAGAAGACCTTCAAGACTCAGGTATCAAATATAAAACTGACATTG
AAAACCGTAGTAACTCGATGTATATTTGTATGTCTCCAAATCCTCACTTG
ACACTTTGACAGAATTCAGAGCATCCCCAGCAGCAACACTATATTATTAC
CATATATAATATTATATATATGCTTCTCTTGATGAGTTTAATTTAGTAAT
TCAATGTTTTGTACTTTGTAAGCACACACCCATCTTAATTTTAGCGGTTT
CCTGGGCTGTGAT
View all "lgf103" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgj2 GTTAGGGATTGGACCTTGTAATTGGAAATCTTGGGGACTCAAGAGCAATT
ATGGGGACAAGAGACGCCTCTAACAATCTAACTGCTCTTCAACTCACAGT
TGATTTGAAGCCTAACCTTCCCAGTACGTTCAATTCTCACTTTGATCATT
TCATTGGTCCTCAAGACCGTTGTAGTCTGCATATCTGATATTTCTTTCCT
TTCTGTCCTCGAGGTGCCTTTGATCGAACTATGATGTGAATAAGATGCTT
GTCCAGATTGATGTTTCCTTTGGGTTGTCGAAATATTTAATCTTTATCTC
TTATTTTCTAGGGGAAGCTGCGAGGATACAACAATGTAAAGGACGAGTTT
TTGCTCTTCAGGATGAACCAGAAGTTGCCAGAGTATGGTTGCCAAATAAC
GACTCTCCTGGATTGGCAATGGCAAGAGCTTTCGGAGACTTCTGCCTTAA
AGATTATGGTTTAATATCTGTTCCAGAGATATCGTATCGCCGCCTTACTG
AAAAGGATGAATTTATAATACTAGCCACCGATGGGGTATGCTAATCATCT
TAGATTCTTACTTAAAATGCT------------------------AAT-C
ATCATGTTTT-AATTTCCAGTCCCTGCTTGGAGTAGCTATCCTTTTAGCA
CCTTCACAGAAAAAAGTTTTACAAAATATATCTGCATCAACTTTCTCATA
TCCGTAAATCTTAATGCATGTAGGTGTGGGATGTTCTCTCAAATAAGGAG
GCTG
View all "lgj2" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgd106 CATGCGCGCCTGCATACCTGCCCTGGGCTCCGATCAGTTCGACGGCGACA
ACCCCTCGGAGGCTCGGCAGCAGTCGAGCTTCTTCAACTGGTTCACCTTC
TGCCTGTCCATCGGGTCCGTCGCCGGCCTGATCCTCGTCGTGTGGCTCGA
GGACACCAGAGGATGGGACATTGGGTTTGGCTTGAGCGCCCTCTTGATCC
TCGTTGCGTTGCTAGTTTCTGCCGCTGGCCTCCCTTTGTACCGCAACCGT
GTGCCTCAAGGCAGCGCCCTAACCAGAGTCCTGCAGGTTGGTTGGATACT
TGG--ATTGGACATGC--TATCTCTCGTTTGATTCAAGACCGTG------
-TAGTAACTGGTTTGCAAATATATGTCAGACATTCAGACTCATCAT---C
GATACTGTCTACTTCCTCCCAGGTTTTTGTTGTGGCGTTCAAAAACAGGA
AGCTTCAGATTCCTGAGAAGAAGATGGAGGAAACACAGCAAAATAGCTAT
GGAGCGGATTCTCAACAAGTGCCATGTCATACTCCTACTACTAATAACAG
CCTAAAGTAAGTTCTTTTCTTAGTTGGAAGTTTCAACTTATTTCAACAAG
AAAACTACGTACACCAGCTATCCTTAATATTGCAGAGTTTAGTAAAATAG
CTATCGATCTGAATTCTTTGATGATATATTGAAATGAAAGCCTGCATAAT
ACTGCAGAGAGTTCAGTTTTTCTATGGTCCACATGGTCTACGCATGCATG
CGCAGCTAAAGTTTTATTCCATGCGT
View all "lgd106" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lga17 GCGCTTCCCTGCACAGGTACACCACACCTATCTGCTTCAATCCAGACTCT
C--TAGTCATGGCGCATGATCGATCAGCTCAAACCGCACCAGTAGCGTGA
ATTTTACTACACTTGTTTGAATTGTTCAACATCACTACTACATCACCGAC
AGACAATA-GGCTAGCG---------------------------------
-TTGCGAGCTGCGACGACGTGTGGAATCGCGTTAGA-TTTTAGGCCCCGG
GATCACACCTCAAGAAACTTA-----------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
---------TTTAAAATTTGTCTACAAACAAGCAATTGGTTAGTTTAGGT
GGAGCGATGGGCCTGTCTGGGGATTAGTCAGCAGAGAG------GTTTGG
TCAGCTTTGC------------TTTTCGTC-TAGTAGGTTGCTTGGTCAG
TCGGCAGAGGATCTGGTCGCAGGCTGGAAAGTGCATGCGTCAGAGCATCT
AGACGCTGCAACTGCAAGCGGTGTCACCTGTAGAGCTGTATAGCCTGATC
TCACAT--------TTGATCATCTCATC---CAGAGGAGTGAAGTTTGTT
TGTTGTTGCCCCAGTGGTTTTCCGAGGTGACTCATGGTTGTGATGTGCAG
GTGCGGGTAGCAACGCGGAAGATCTACGACCCCCTGGAGGAGGACGCCTT
CCGCCCCATCCTCCACCACTACGACGGGCCCAAGTTCCGGCTCGAGCTCT
CCGTCAC
View all "lga17" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lga14 GGTGACATGCTATACGCCACTAC--------TATATATAGATATCTTATC
CAATTTCTGCTATTATTTTC-TTTTTTCAACATCACGTTACCCTCATTCC
AGTCACTCTTTGCCTGCAGCAAATAATGCAAGTGCAATACAAGATACCAG
ATTATGTCCACATATCTACGGAATGCCAGCAACTTCTTGCCCGTATCTTT
GTTGCCAATCCAATGAGGGTAATGATTTCAACCTGTAAATTACAGTCATG
ACTTGTCGTGATACACGTGGGATAGTGTAAAACTTGGTAATTTGAAACAT
TGATGCAGTATTTTTATGAATATTCTCCAGAGAATCACAATGAAGGAAAT
AAAGAGCCATCCATGGTTTTTGAAGAACCTACCACGGGAACTCACGGAGA
CTGCACAAGGCATGTACTACAGGAGGGATAACAGGGTGCCTTCTTACTCA
GACCAATCGTCGGAAGAAATCATGAAGATAGTTCAAGATGCAAGGACCAT
GCCGAAATCATCCAGATCAGGCTATGGGTGGAGCACTGAGTATTCGGATG
AAGAAGAAGAGAAGGAAGAGGAACACAGGCCAGAGGAGCATGAGGAACAG
GAAGATGAATACGATAGGAGGGTGAAGGAAGTCCATGCAAGCGGAGAACT
CCGTTTGGACGCTCTTCACATATGAAAGCAAGTGGAAGAAAGTTACGTGT
ACATAACTGGGTTGCGGATCTGAAGGATCCAGTGGGATGTATGCAATTTT
GGCTTCA
View all "lga14" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgb9 TGGCTTGCAATGAATAAGTTTTCTGGATTCATCTATGTGCACTTTTAATT
TAGGATCTTCATAACTGCTTATGGTGCTTGATTTGTTTTTTTTTACTAGA
GTCAAAGTATGCTATCAAGATTATACCACTCTTTATCACAATTGATCCTC
AACGTGATTCACCTTCTCAGCTTAAGGCATACCTTAGTGGTAAGATATTC
TGCTATTGGGGTCAGAAACATTGAAATTTTAGGCTATGCTGCAAGTGATG
ATTCGCCTCGTTTTAACTGCAGAGTTTGACCCAAGAATAGTAGGACTAAC
AGGCCCCATCAGTGCAGTAAGACAGATTGCTCAGGAGTACCGTGTTTTCT
TTAAAAGAGTAGAGGAAGTTGGTCAGGACTATCTTGTAGAGAGCTCTCAC
AATATGTAAGTGCATGTTGTGCACCTTGCCATGTTGATGAATGTTTTCAG
ACATTGACCATCTGAAGTTACAGGTACTTGCTAGATCCATGCTTGGAGAC
AGTTAGGTGCTTTGGAACTGAGTATGAAGCATCAGACCTTGCTGAGGCGA
TAACAACA
View all "lgb9" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgf10 ATGATCCTGTCCTGGATGGTAGTGTCTCCAACGGCCATCCTGAAAAGGTC
AAGAATATTTGGGAACTAGTTGTGCACAAGCATGAAGCAAGTGGGAAAAG
TGTTGAAACTATCATTGAACAGATAAGTCAAGCATTGGATCAGAAGGCTA
TTTCTGCCAGAAGAGATGATTCAGATGTGAGTGACCGGTCTGAAATAGAG
AAGGCAGTGAGAAATATGGTTGAGGAAATCACTTCCATGATCCGAACATA
TGAAGAAGACAATGTTGCAAGATCAATAGCGCTGTTGCACAACAAGTATG
AACTTTTTCGCCACCTTGAGCGCCTGGTTCAGGTTTGTCATGACCTACTA
GAAGGGAAATGGAACCTTGGAAAGTTCATAGATGAGGTTTGCCTCATCCT
AAAGTATATAGTGAGCCATTACTTCTCAGATCAAGATCAGACCGACACTG
TGAACAGTTTAGAGAATTTTGATGGAGTTAAGTCATTGAGTACAGTTACC
GCAAATGGTACACGTGACACTGAAAGCGCTAAACCAGCAGCAACTTCAGC
TATTCAGACAGAAGCAGAGGAAGAATCAGTTCAGTCAGCTGGAAGCCAGA
TTATGGCCAATCCTCAGAAGCCTGATATAGAACTAATACATGCTATACAA
GTCCAGGATGATAGTATCGTTCCAGG---------GACATATTATGAGAT
AAAAAGGTAGATTTATATGTCACTACGTGTATTACTCATGTTTTTT
View all "lgf10" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lge8 TTATTGATAAGGTATATCCGAGCACACATATTTCTGTATAGGGTATATAT
CTATCGAACTTATGCTTGGTTGCTCATACTTTTTGATGTTACTAGACATT
TGAGGAAGCGGATACAAAGCACGACGGGAAAATCGACAAGGAGGAATGGC
GTAGCCTTGTCTTGAGGCATCCATCTTTGTTAAAAAATATGACCCTCCCA
TATCTCCGGTCAGTACTCTTGATGGGTTTTCCCTTTTCTTACAATTTGAG
TTTTCTTCCTGAACTTCTACTTGGGTTCCTAACTTCATATGTGACGCTCC
CTAGTTCAGTATTGTAGAGACTATATTTGTTAACCGCACAGAACATACAA
CACCTGCACCCTCCATTTATCTGTATTTGTCCATGGTCTTGGAATATGCT
GTTTTAGTC--------AATTGTTCCTCAGT-GGTCAAAACTATTGCGTT
TTATACTTTTATTGTGAATTTTCATGTTATGATGTACATGATGTGCACAG
GATACTTTTGCTGTTTCTGATAAGCTTTATTTCAAGTGCCCTTTGGTATA
CTCTGTGTAATGTCTGTTTAATGTCTTCTTAATCGTGATAATGAAGATAT
TAATAGGCTTGTTGTTTAGAGAAGCCAAAGGATGCTAGATCAGTTGGTCT
AGGCACTCTGGCGGCACCTCCCAGGTCCTGAGTTCGAATCCCAGTGGGAG
CGAATTTCAGGCTAGGTTAAAAAAATCCCCTCGCCCGTCCTCATACCAAA
GCACTGGGGGAGCCCTGGCCTAATTCTCACTTGGGCGACGGAAAGGCCAT
CGTGTATGGATGGGGG
View all "lge8" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgd103 CATATGGATTTCAAGATACATTCTCGAGGTACCTCAAACAATAATTAAGG
ATTTCCCCCATATCGTGTCATTTTATTTCTTTTTCTTCTTCATAATTATT
AGAGCATACAGTATTTTACAAGTTCAGCACCTTATTGTAGTAAGGCATTT
ATGATTACACACAGCAACATATCACGATTGAATTAGGCATTTGAGAATAA
TTTTCTCCTGGTGAAAAATTATATTTCATTTTATCTGTATTGTTCAAAAT
ATGAGGCCTGAAGCCCATGATTTCAACCTTTAGTTAATACCAATTTTTAC
ATCACCATAAACACTTCTAAATATTGTCCTACTCACCTTTATCAGAGAAT
CACAGAGCAAGCTGGGGTTGTCCTTACCCTTGATCCAAAACCAATTCAGG
TATGTCCAC--------CAGTAAGTTGTTTCGAATCATTACAATGTAATA
GGATTAAAGTAATCTTAACATATAGCAATACTGTATTGGTGACAGGGTGA
CTGGAATGGAGCTGGCTGCCACACAAATTACAGGTTACAGTCTTTTATGA
TAATGCTTCATTTCCTTCCGTTGTTTGTTCATGGTAATTTTGTCATTAAC
GGACAGACACCAGAATGCCTATAGCAGTATAATTTACCATATGCTGACTG
CTGAGTGTTAAAGGAAAAAAGTTTGTTCTAATGTTCTAGAAAGGGAGTAG
AAGTGAAGTATTAGTATATCATTAATAAATTGTTGTCTAGTGTGATTGGA
TCCAGATGATTGTCCATTTGCTTCTATTAATTACTAACTTTCGTTATTTA
ATATTTTTCTCAACACATTTGACACACTGGGACTGAC
View all "lgd103" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgd103 CATATGGATTTCAAGATACATTCTCGAGGTACCTCAAACAATAATTAAGG
ATTTCCCCCATATCATGTCATTTTATTTCTTTTTCTTCTTCCTAATTATT
AGAGCATACAGTATTTTACAAGTTCAGCACCTTATTGTAGTAAGGCATTT
ATGATTACACACAGCAACATATCATGACTGAATTAGGCATTTGAGAATAA
TTTTCTCCTGGTGAAAAATTATATTTCATTTTATCTGTATTGTTCAAAAT
ATGAGGCCTGAAGCCCATGATTTCAACCTTTAGTTAATACCAATTTTTAC
ATCACCATAAACACTTCTAAATATTGTCCTACTCACCTTTATCAGAGAAT
CACAGAGCAAGCTGGGATTGTCCTTACCCTTGATCCAAAACCAATTCAGG
TATGTCCAATTGTCCATCAGTAAGTTGTTTCGAATCATTACAATGTAATA
GGATTAAAGTAATCTTAACATATAGCAATACTGTATTGGTGACAGGGTGA
CTGGAATGGAGCTGGCTGCCACACAAATTACAGGTTACAGTCTTTTATGA
TAATGCTTAATTTCCTTCCGTTCTTTGTTCATGGTAATTTTGTCATTAAC
GGACAGACACCAGAATGCCTATAGCAGTATAATTTACCATATGCTGACTG
CTGAGTGTTAAAGGAAAAAAGTTTGTTCTAATGTTCTAGAAAGGGAGTAG
AAGTGAAGTATTAGTATATCATTAATAAATTGTTTTCTAGTGTGATTGGA
TCCAGATGAGTGTCCATTCGCTTCTATTAATTACTAACTTTCATTATTTA
ATATTTTTCTCAATACATTTGACACACTGGGACTGAC
View all "lgd103" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgj112 ATGGGTGATTTTACTTTTCGGCCTGTCGTATCACCAGCGCCTACTCCAGA
CTTCGCAGCACCAAGCAGTCAAATGGGAATACAAGACAGAACTCACCCTG
GACCATTCTTCCCTCCTAGCAATCAGAACCCCAACCAAGGTTTCCAAAGG
CCTTTTGATGGCAGGCCTATGAATATGATGGGTCAGCCTCGGATGCATCC
TCCACCTCCACACTTCCATGGAGCCTTCTCCAGGAATCCATCTCCTCTCG
AGTTCCCTGCAGGGTTCCAGGGGGTCTGGCCAGCAGTACAAGCACCTCAT
ATGCCGGCACCATCAAATCCGTCAAATTTCCTGCCTTCCCGGACATTTCA
GTTGAGGCCACCGCCACAACAGGATATGTCTGGTGCAGGTGGCAACAGGC
AGGGTGGCAATCAAATCTACAACCCTTTTGCACCAACAGCAGCTCAGAGA
ACAGAGACGGACCCTGAGTATGAGGATCTCATGGCATCAGTTGGCGTGAA
GTAGCGCTGGCTGCTGACCCCTGATGTGTGGGAAGTCAATCCAAGCTGTG
GTTAACTGGTGACACAAACACAATGGCTCTATTGCTTGCCAAGATGTGCG
AGTTACTAATCTCCTATGTATCTCTAGATGACTAGATAGTGAATTCCATC
AAAGGCAGATGCCTGAAATAAAAATGAGTGGACCTTGTTTGA
View all "lgj112" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgg105 TGATGGCGGACTGGGAGGGGATCCCGGCGCGGGAGCGGCGGCAGATGGAG
GAGATCCTGCAGCTCGACATGGAGGAGCTCAACGTGGAGGTCGTCGACGA
CAACGACGAGGAAGAGGAGGAAGACGAGGGTGACGGCAACGAGGAGGACG
ACGTCGTCGATGCCTTCCTCAGGTGACTCCAAGGCCACACGGCCACCGCA
CAGTCCTTCCTTCAACTCCATGCGTGTATTTTACCCTTATCTTCCTTCTC
CGACATTGGGGCCCCACTGTGCTGGCGTGCTGCTCCGTGTATTTGTCGTA
CGGATGCTGCTTACCCATTTCTTGTGGAGTTGAGGCCGAGTTG-------
--AGGCCTAGCCAGTGCAGTTAATGTTCCGCAACATTTCAAGGTAGTAAT
TTGGACGCTGTGGT----GATCGTTAGCTTATGAAGATCCTAAGAGCCCC
GAATTCAGTCTTGAAGATCTAGTGTATTTGCCTAGGATGGGGAATTTGGG
GATTTCAGCTTAAAGGAACAACTCTGGAAAGCCGGGGCAGTGTTAACTTT
GCATCCTTCACCGACATTTCAGATCCAATGTCATGAACTCTTGATCATTT
GTGATTATTGATTCATTCTTGCAGTGCCTTGTGTTTTGATTTAAATGGAA
TTCATGATCAGGTGTGGTGACTGCTGAAAATTGCAGTGTAGCTTAGCATT
GCTCAGCCTTACAATTTGTGTGCTTATTCACTTCA
View all "lgg105" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgd10 TCTTTTCATATTCTTCACTGCTATTTACTGCCTTGGCCTTGTGACATACG
GTATTGCTGTTCCATCTGGTCTCTTTATCCCTGTTATACTTGCTGGGGCT
ACATACGGGCGCATAGTGGGGACCCTTCTTGGCCCGATATCAGACCTTGA
TCCTGGACTATTTGCACTTCTTGGTGCGGCATCTTTCCTCGGTGGAACAA
TGAGGATGACTGTATCAGTCTGTGTGATACTTCTGGAGCTCACCAATGAC
CTCCTTATGCTCCCATTAGTCATGCTCGTTCTTCTGATATCGAAGACTAT
AGCCGACAGCTTTAACAAAGGGGTTTATGATCAGATTGTAGTGATGAAAG
GTTTGCCATTCCTGGAAGCTCATGCCGAACCACACATGAGGCACTTGGTT
GCTGGCGATGTTGTGTCTGGGCCACTGATCTCCTTTTCAGGCGTCGAGAG
AGTGGGGAATATCGTTCAGGCGTTGAGGATCACAGGCCACAACGGATTTC
CAGTGGTCGATGAGCCACCTCTGTCAGAAGCTCCAGAACTTGTTGGGCTT
GTGCTTAGATCCCATCTGCTGGTCTTGCTGAAAGGCAAGGGCTTCATGAA
AGAGAAGATGAAAACCAGCGGTAGCTTCGTGCTGCAAAGATTTGGTGCCT
TCGATTTTGCCAAGCCCGGCTCAGGAAAAGGTCTGAAGATTGAGGACCTG
GATTTCACTGATGAGGAAATGGACATGTATGTCGATCTCCATCCAATCAC
AAACACATCGCCGTACACGGTGGTTGAGACCATGTCACTTGCAAAGGCCG
CCATCCTTTTCCGGGCACTGGGACTAAGGCACCTGCTCGTTGTG
View all "lgd10" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgj11 TTCACTCTGCTACAAACAATTAAGTGTCAAATGTTCAATCTCAGAAACTA
TTGTAGTTCACCTTTTATTTAGCTCTAAGTGGTTACTATCCAACCATACA
TGTACATCGATGTTGATCTTTTTTTGCTACTCAGGAGCCATATGAGTTAG
TTGAAGCCCCTGTTTCAACCCCACTAGAAGACTACAAGAAAGCTGTTATC
CCATTAATTGAGGAATATTTCAGCAATGGTGATGTAAAATTAGCTGCTTC
TGATCTTAAAGAATTGGGTTATGATGATTTCCACCGTTACTTTGTCAAGA
AGCTTGTTTCCACAGCAATGGACAGGCATGACAAGGAGAAAGAGATGGCA
TCAGTGCTTCTATCATATCTTTATGGCAACGTGGTCAGTTCAACTCAAAT
CAGACTGGGCTTCGTGCTGCTATTGGAGGCTGTTGATGACCTGGCTGTTG
ACATACCTGATGTGGTTGATGTGCTCGCACTTTTCGTTGCACGTGCAGTT
GTTGATGACATTCTGCCACCTGCTTTCCTCAGCAAGGCAAAAGTGAGTCT
CTCAGGATCGTCAAAGGGTATGCAGGTTGTACAAATTGCAGAGAAAAGCT
ATCTTTCAGCACCCCACCATGCAGAGTTAATTGAGCGACGATGGGGTGGT
TCAACTCACATCACAGTAGAAGAGGTGAAGAAGAGGATTGCTGATCTTCT
AAAGGAATACATCAGAAATGGTGATACAGCTGAGGCTTGTAGGTGCATTA
GGGAGCTGGCAGTGCCCTTTTTTCATCATGAGGTGGTGAAGCGAGCTCTT
ACTCTT
View all "lgj11" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lga111 ACTTGCTCTTTAATGGATATATCAAAGTATCTTTACAGATGAAGTGAACT
ATGCCTAGTGTTGTTGTGTTGGAAACTGTGTCAGTTTATAGTGGTATGTT
GTCCTGCCTTCATTGGTATAATGCCTTTCTATGTCTGTACTAGATGACAT
GTTCTATGACTGAAGATGGCCTTTCCGAAAGTCTTCAAGAGATGGATTTT
TCAGGTATACCTTCCATCATTACTGCTAGACTTTTGGTGTTAGGATGGGT
GTGTTCTTTTCCATTCCTAATTATAGTGGTAATTCAGGTACCGACTGTTT
GCTGAACTCGGATGGGATTGATGAACTGCCAGAAGAATGGCTAGTTGATT
GCTCACAAGATATCGAACCTTGTTTACCTGCAGAAGAAATGTATGTGTTT
CATTCCAATATTCATAAGCGCTTGGATTTTTTAGTTGTTGAGTTCACTGT
CATTGAAGATGAAGTATTACTACTTATGGTATCT-AAACCTTCTTAGTAG
GAATAGCCCTGCTGCTGCCACGGAAAAAGCTGTCGATATCTCTGGTTGGT
ACAAACCTCTCATGAGATTTCATCCTTGCC--TTATAGCAGAATTCTAAG
TTGCTGATAGATGAATGCTATGCTTATTTTTCAGTGCATTCGAATTCTTC
GCCTCGCCAACAGTCCATCGTAGTCCAGAACAATCTTGCACAAGCTAGAC
CTACACCACTGAAAGGTGTGCCCAACTCTTGTCCATGTTTGCTTAAAGAA
TCATGATTTTTATTCTCCTTCTCAAGAACAG
View all "lga111" genotypes
Purdue No. 49018   bicolor, NULL Cameroon   lgc18 CTACTCAAGCTAGATATTCCGATCACAAGTGGTCAGCTTACAGAGCCTGG
ATTTGGCTGTTTGGCGGAAGTAGATGGGAGTTTAGTTGCAGTAGGCACTT
TGGATTGGGTGCATGATCGTTTTGAAACTAAAGCATCACCTACTGAACTG
AGAGACCTTAGAAACCGGCTGGAGTCTATGTTGTCAAGTGAAGCATCATC
ATCAAATCAGTCAAAGTCAATTGCTTATGTTGGTCGTGAAGGAGAAGGAA
TTATAGGTGCTATTGCTATATCAGATATTTTACGAGAAGATGCAAACTTA
ACTGTGGAGAGGTATTTTCTGGAGTGATTGTTTGCATTTTAACTGTGTTT
TCTCGGTACAGATACATTTCTCTTATCCAACAGGGTTATCCTCAGAGGCG
TCGTGAAATGCTGCTGCAAGATTCTTAGATATTTTAATGTTATTTTTGAA
GTAGCATGCAA--------GTTTTGCAACTATTACTGCCTTATCTGTATA
GTTAAAGCAGTGCAGCATGTTTAAACTTGTCTTGTCTTGTTAATCATCAG
GTTGCAGCAGGAAAGCATTACAACGTTTCTACTGTCAGGGGATAGGGAAG
AAGCAGTGACAAGCATCGGGAGGACTATTGGAATCAGGGATGAAAACATA
AAGTCTTCCCTAACTCCGCAAGACAAAGCAAGCATTATATCAACTTTGCA
AGGGAAGGGACACAGAGTTGCAATGGTAATGAAATC
View all "lgc18" genotypes
[ Download ]