grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "PI152702" from the experiment "Hamblin, Casa, et al. (2006) Challenges of Detecting Directional Selection After a Bottleneck: Lessons From Sorghum bicolor. Genetics 173: 953-964.".

E.g., Germplasm L-WA58, Marker/locus pSB0080.

Items 1 to 25 of 200.       of 8 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
PI152702   bicolor, NULL Sudan   lgf6 AAACAGTCGGAGGAGAAGAGGAGGATGGGCTTCGAGAAGCAGATCTTGAG
AGCCGGGACCGGCCCCAAGCCGGTAAAGGGCCAGAAGGTCACCGTCCACT
GCACCGGCTACGGTTCGCTCCTTCCCTTCATCCCATAGACCTCTGATTTA
CCACGTTGTTCTTGGATCCGCATCACTTCAGGGTTTAGAGTTAGATTCTT
TCAGATCCATGTCGTGTAGTAGCCTCGATGAATAAGCGGCGACCCTTTTT
TTCTCGGCTTTGATGCTTATTAGGATGCGATGTTCAGTCGTAGGGTTGAG
ATCGATCTGATCCAGAGTTGCAAGCGAACCTAGTGCACTGCATAATTCGT
TTCCTTTTCTTTTGTGTTATGACTATCACTATCTGATCTGCAGTAATTGT
TTGCTAACTTTTGCTTACTGCTATGGGTTTGTTTTCAGGGAAGGATCGTG
ATCTATCCAAGAAATTTTGGAGGTAAACTATCAATCTATTTTCTTGATTT
ACATCGAAGTGTAGCACATCAGTGGAATAAGCACGTGTACACTGAAAGTA
GTTCTTTTCCTGTCAGTCACTATGTTCTGTTGTTTCTTTCAGCACCAAGG
ACCCTGGGCAGCAGCCATTCAGTTTCAACATTGGTCTGGGTTCAGTGATC
AAAGGTAATCATGCCACATATCATCAGTTCATGTGAAGACCTTATAACTT
TGCCTGTTAGTTATCTTCACGTGTATTACTTTGTGATTTAGCAAGGGTTC
CATTACCTGATCATTCTGATTGCTTCCAGTCCGTATGTTATATTGGTATA
T
View all "lgf6" genotypes
PI152702   bicolor, NULL Sudan   lgj6 AAAGCTAGTGCACGCCGCACCACAAAGCTTTACTACTTTGATTCAGGTTT
GGCTGCCAGGTGCAGAGCTGTAACATGAAGTACCCTCATTCTATTCGCAG
GTTTTTGGACCAACAGCAAAGCAGAAGGACTTGTATGACCAGGCCATCAT
TCCTATTGTAAATGAGGTCTTAGAGGGATTCAATTGCACCATTTTTGCGT
ATGGGCAGACAGGCACTGGGAAAACGTACACCATGGAAGGAGAGTGCAGG
AGAGCCAAGGCAAGTCTATGCTGTTTTTTATGACTGTATTATGCTTCTTG
GTTGTCTCAATTGCTGATTACTGCTAGTGCTCGAATGCTTGCAGAGTGGA
CCAAAGGGCCAATTACCTGCAGA
View all "lgj6" genotypes
PI152702   bicolor, NULL Sudan   lgi4 AAAGTTTGCAGCATGGCAGAAGTTTCATAGCCAGATCAGTCAAGTAGAAG
CTCGAATTCAGAGGCTAGGCGAAATTAGGAATCGATATGGCATCTTGGCA
GGTGAAATAGACAGGAGTAACAAATTGAGGAAACCCAATCAGCTCTTTAT
GTCAGATTCTTCTTACTTAACTGATAGCTCTGAAATAGTGGGGTATGTTG
ATGAAATTGGAAGATTGACACAATGGTTACTTGAGGACAAACAAGAGCGA
ACTCTCATTGCCATCTTTGGTATGGGAGGTCTAGGAAAAACTACTATTGC
AAGCAGTGTGTACAAGAATCAGAATATCACAAGAACTTTCAACTGTCACG
CATGGGTTACTGTATCTCAGACTTATCAAGTTGAAGAACTACTAAGAGAA
ATCATAAATCAGCTAATTGATCAGAGAGCAAGCATGGCAAGTGGTTTCAT
GACCATGAACCACATGAGGCTAGTTGAGGTAATACAAAGCTATTTGCTAG
ACAAAAAATATTTAATTGTCTTGGATGATGTATGGGATAAAGATGCATGG
TTATTTCTAAACCATGCGTTTGTCAGAAACAACTGTGGAAGCAAAGTGCT
GATAACTACTCGGAGAAAGGATGTATCTTGTTTGGCAGTAGATCACTATA
GGATTGAACTTAAAACTCTTCAATATGCTGAATCCTGGGAGCTTTTCTGT
AAAAAGGCATTTGTTGCATTAAAAGATAGCCAATGTCCTGAAAACCTTAG
GTTTTTTGCAGAGAAAATTGTTGCCAGGTGTCA
View all "lgi4" genotypes
PI152702   bicolor, NULL Sudan   lgj109 AAATATACCAATACGCGTGCAAGCGATTACTACTACCCCCAACAAGTTAA
CACGTTCTCGGCCATTTGTGACGCACCTACGAGGTTGTAATTTTAGCTGT
TCGCACAACAGAGTGAGACAAAAAATCATTTTGTTGCGTGAGCTTTGCAG
GTGGCGAAGGAGCAGGCGGAAAGGAGGGAGACGGCGAAGCAAATGTTTGA
ATTGGGGCAAAGGGCCTACGGGAAAGGAATGTATGGACGCTCAATTGAAT
TCTTGGAGGCTGCACTCACTATCATACGTCCCTCCTCTCTCCTCGGTGGC
GAGGTAATATCTCTGTAGTTGAGAATTTGAGAAAGGATGAAAACGGTCGG
AAATGGTCGAAAACGGAATTACAATGTAGAAAACGAAAGCGGTCGGTACG
GAATATTTCTATATTTTAGCAATTAAAGAGTACAAAAAAAGAATAAAAAT
GGTTGTGAAACCAACTGAAACTGACAAAATTTTATGTTTGACAAAATTCG
AAAACAGTTTCATAATATAGAAAACGATATCATAATGTAGAAAACGAAAG
CGGTCGGTACGGAATATTTCCGTTCCGTTTTCATCCTGGATTGAGATTTC
TGTAGCTTTCTCATCTCTGGCTGTATGCCAATTAACTCTTTTCGAGTTTG
TTGGAACTTGGAAGGGAAAACCTATGGCTAAGATTCTGTACGCATCTTTG
TGATATAGTG
View all "lgj109" genotypes
PI152702   bicolor, NULL Sudan   lgf102 AAATTTGTCCGGTTCTCATGCCAGTTTAAGAAATTATTGTTCCGTTCTTT
TAGTTATTTATAAATGAATTTTTGCACTATTAATTCTTTCTCATTCCTTC
AGACCAAAATTTCTCCTGCGTTTGTGCTATTCTTTGACTGTTCTGAGGAA
GAGATGGAGAGACGTCTCTTGGGCCGCAATCAGGTTTCCTTCATCGTTGA
CCAATTGTGTTTTTTAATCATGAAATTCTTGTTTCCAATATTTCTTACTG
TCTTTGCAGGGAAGAGTTGATGATAACATTGAAACTATCAAAAAAAGGTT
TAAAACCTTTGTTGAATCAAGTCTGCCTGTCATTGAGCATTACAACTCAA
GGGACAAGGTTAAAAAGGTATTGATGAACTTTTATCTTTCCAGGGGTACT
CCTATTGCACTCCGATCCGATGATGCAAATATGTGATGTATTATACCGTA
GAAATAAAGCCAGAGTAAGATGCACATTAGAATAAATAAGTGAGGTTAGA
AGGATATTTTAGATCTATCGTGTGTGTATTCC------------------
AGTCCACATTTCAATTAGTTGATGGCCTTTTCTTTTGCAATGTTTTCACT
TTAGCCCCCTATAGTAACTTTTCATTTTATCAGATTGATGCTGCAAAACC
AATTCCTGAGGTGTTTGAAGACGTCAAAGCCATTTTTGCCCCATTTTCTT
CAAAGGTAATTAGGTTTCACTTGTTCTTTGTGTATTCTTTTGC
View all "lgf102" genotypes
PI152702   bicolor, NULL Sudan   lgc21 AACCAACCAAATTCACCTGTTCCGATTGTTTAATGCGACATGACAAGCTC
AAACGACTTGTTCCTGTTACCATTTGAAAAGGCTCGCCGGGATCTCAAAT
TTACTGTGGACAA-----TAATAAATAAATAAA--------CAATCTAAT
TTCATTTCCAGATCTACTACTGTAAATATGATCAGACGAGCGGGCAGACG
CCGGTTGAGCTTGAGCCTCTGCCTATACTCCTGCTGAATAAACAACACAC
GCTACTGCAGGGCAACAATTACACATACAGCTACGAAACAGCCACTTTAC
ATCCAAATCCAATCCAATCACCACTGCAGGAT------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
---------------------GTACTAACTAACGTCTCAACTCGAGTCTC
GCAGTACCTATAAAAATGCCCAATGTCAGTCACTCGAAAATCTGGGCAGA
ATGGTTCAGCATCGCCCACTTT-----ATACTACTCTAGCACGAGCATCC
CTACTGGTGGTTTCAGTCTTCACGTTATCATCGGCATCCGCCTCAGGCTC
GCACTGCCCGCTTTCAGGGCCAGAGACCTCCCCTGGGCTCCGTTTCTGAC
TATCCTCCACCCCGCCGTTGTCGGAATCCATTGGTGCCGCCCCTTCTTCT
GGATCGCCACCACTGCCACCGCCATCGGTTTCTGGTGTCGCAGCAACCTG
CACAGAGCAG-CCATAGCAACAATGTAGACATGACATTGTTGGTGTTTAC
AGATGATGTTAAAATGACAA-TTATGATCAAGAAGACAGTCGA
View all "lgc21" genotypes
PI152702   bicolor, NULL Sudan   lgd13 AACCTGGTTCTTACCGACCCAACGAAAGGGATGGGTGGAACAGTGAGAAA
AGCAGCAGAGCTTTATGAGAAACATCCTAGTGCATACATGCTTCAACAGT
TTCAGAATCCTGCTAATGTCAAGGTACTCTCCCTTTCTTGTTCTTCAACA
ATTTTGAATGATCTGGCCATGAGTTACACTTTGTAGGGGTAGTATTTAGT
ATACATTTGAAGCTGTTTCTTAAGGGTTACTGACTAAATCTCTGACAGGT
ACATTATGAGACAACGGGTCCAGAAATATGGGAGGACACACTTGGACAGG
TTGACATTTTTGTCATGGGCATCGGGAGTGGCGGTACTGTCACGGGAGTC
GGCAAGTACCTCAAGGAGAAGAACCCTAATGCAAAGGTACTATCATAGAC
CAGACAGAACAAAATCTCATAGCTAGATGCTCATAAGGTGTAGTTTCTGG
AAGTTGTATTCAGTTATGTTGTAAATCTCATAGCGTGTACATGGAAACTT
GCAGATATATGGAGTTGAACCTGCTGAAGCAAATGTTCTGAATGGTGGAA
AGCCAGGTGAGCTTTGGCATTCTTTAAAAGAACTACTTCCCCCACTGTGC
ATAGTTTTAATATCTTTCAATATTGTTTGCGGAATCTAATTGCAGGACCT
CACCTCATCACTGGAAATGGAGTAGGGTTTAAGCCAGACATTTTGGATAT
GGATGTAATGGAAAAGGTTCTTGAGGTAATGCTGAAACTATTTGTAGTCA
ATACCCTTTTAAAATC
View all "lgd13" genotypes
PI152702   bicolor, NULL Sudan   lgb102 AAGCGCCACTTCACTTCGGACCTGACTACTTTGATAGTTTGATGAGTGCT
CAAGTAGGTCAATCTGTTTTTTGAGGCAAAGTAGGACAATCTGTTTTTTG
AGGCAAAGTAGGACAATCTGTTGTAATAGGAGCTGCTCTTCTTTTTCGGT
GTTAGGTGCTTGGTGCTAGGTGTTGGGTCGGTGGTAATCCTGGGATTACT
GTTGGCCGGTTGTGTACTTTAAACTCTACTTCCTCTCAATCTGTTGACAC
GGTCGCGAAAAAAGTAGGACAATCTGGACTTCCCTGTGCTTTGTAGTCCT
GCAGATTCTTAG--------------------------------------
--------------------------------------------------
TATTCTGAATATCTCAGTTTATTTAACCTTTGCAGCAGAAGATAGCAGTA
TGTTTGGTCCTAACTTAGATATACCCAATCTGAAAGCTTAAGTATTTTTT
GAAGAGAAGATGTCTGAAAACTTCAGTGACGACATGGGTTTCAGCTATAG
CAGTCTTACACGTCCTT---------------------------------
--------------------------------------------------
---AAAGACAGAGAAGATATTAATTCAATGTTTAGAAAGAATAGGTGCTA
TGGGCGCATCTTATCATTTATGTGGGGAGGGGAACATATATTGTGAAAAT
TGGAATATTCCCTTACTAATAAGTCTGTATGATTGTGACATATATGTAGT
AGTATATAAATACATCAAAGGGCAGCATGCATTTACATGTATTTAGCATG
CCAGCGCACTTCTGAAGAATGAAGTGTGATGAATGCTGAACAGATTGAGT
TCTGTTTCAGTTGTGATGAGT
View all "lgb102" genotypes
PI152702   bicolor, NULL Sudan   lgd1 AAGGAAACAACTTCATAATGTAAACTTGATGTTGTTTCCTGGAACATCCT
TACTAACTAAGAGATTGGATGGATTTATTATGGCCACAAAACCAGGTTCA
CTACCTGCTTGCTTACCACTAGCCACATTTGTGCCTTGTGGTTTATGGTT
TTGGGCATACCATGACCTCCTTCCATTTGTTTGTGTGCCCATAATACTCA
TAATTTTGAAACTATGCAGGTGAGGCAAAGGATATACATGAAGTTTTTGG
AGTACCAAATGGTAAGTTTATGCCTAATGGGAAAGCAAGTGAGCACTTCG
AACTCCATGACCTTGACTTGTCCGGGACAGAGTTTAAAGCTGAGGTTTCC
ATGAGTGGTCCATTCAGAACACTGAAACATGAATGTGGTTCAGCAGCATG
GTTTCAGTCTACTAAGGTTTGGTACACCAGCTCTTGAGACTTTAAGCTCT
TTTTACACATAAAAGAAAAGGATTAATGTTTCCTATATAAAAAA--ATAT
ATATTCAGATGGTTGCACATAAATATCCATTTCCATTATACCGGTTTACT
TGTATACATTTGTGAGCTTTGCAGTTGCATGTAGTCCACGCAGGTATACA
GTCCATTTGCAATTTTAGTGATCTATGAGCTCAAATCTTACTAGTGCTAC
TTTGTTAGCCAGAAGCATGCTGTTCTTGTATCTCGTCCTC
View all "lgd1" genotypes
PI152702   bicolor, NULL Sudan   lgc111 AAGGTTTCAACTTGAACAATGCCAAGAAATAATTACGGCAGCAGTGGCAG
CTGGCTGGGTGAAGCTGAGCTGCGAAAACGCAGGCCGGGCCTCACTGCTG
TAGATCGGATTATTCGCGCCTATTCCTAGTTCATCCATGCATGCACGATC
AGTGAGATTAAACAAACGAAAAGATATCCTTTTCCATAGAAGCCGGCGTC
GTTAAACAATGAACACAACAAACAAAAAGTACCTAGGCAGTTCTCTGAAC
CGTGCATAGCAAAAAGCGTTTGTGTCTGAAGGCCGTGGAGTGGCGGCGAC
AAGTTCAGAGAGTCGAACCGGCCATACTCCGCTGCCAGTCTGCTCAGTGC
AAAACCAAATTCAGTTACTTGAAATGGCACACGATGAAAATGTCCAGCGA
TGGAACAGGAAGAACACCAACTCCCGGACGAAGCCAGTGCAGCGACATGG
AAGATAGAACTCACATCCTGTCCAGGCCCACGGATCCTGCCGATGAACTA
GAGCTCTCGCACCTGGCTGCACGCATCGAAGAAAAGCCACGATGACTAGA
CTGCATTCCATCCAGAGGGAAACGCGACCAAGAGGATTGCAGGACGGTAG
AAGAACCAAGAACGTACCGTAGTCGTCGCCGTACTGCAGCAGGAGCGAGT
GCGGTGCAGCAGAGTAGTTCCACATTGCGCACCGATGGAAATGGAACTCC
GATCGTCGGCAGCCCGCCAACACGTACGCAGGTCCTCTCACCGCCTGGAA
ACCAAACGCCATGCCCGTGGTGTTGAGGGAGGGAATAC
View all "lgc111" genotypes
PI152702   bicolor, NULL Sudan   lgc20 AATACCAGAATCTGTAATGATGCATGACTTTGCCATCACGGAGAATTACT
CTATTTTTATGGACCTCCCTTTGTTGTTCCGACCAAAGGTGTGTGGTATT
GGTGCACAGAAAACCTTCTTTGCATTTTCTTTCTGTGCTACTTATTTACA
TTCAGCTGACAGATGTCCTAGTCGATTTCCATTTAATGCACTCGGGAAAT
GCTTCAAACCCGTTTTCATAACTAGATCCTTATTGTTTTTTTATTGTTTA
CAGGAAATGGTGAAGAACGGTGAGTTTATCTACAAGTTTGATCCTACAAA
GAAAGCTCGTTTTGGTATTCTCCCACGCTACGCAAAGGATGAAAAAGTCA
TCAGATGGTTTGAACTCCCTAATTGCTTCATATTCCATAATGGTATGGCG
CCTTTAGCTTTCTGCTGAATGTATGACCTTTTTAGATTTTTCTTGAACCT
CCTTTTTTTTTGGCAAACTTGTGCTTCTCCTTTAGAAGCTTCTGATAGAA
TTATGCGACAGTATAAAGAACAGAACTCAAGCTAGATCCGTTTCCAATTA
CTGTGCTTGACTATGCAATTCCATGTATTGCACTTTCTTAGTTTGAGCTG
ATCTTTGAGGACATGTATTGTCACAGCTAATGCTTGGGAAGAGGGTGATG
AAGTTGTTCTCATTACCTGCCGCCTTGAGAATCCAGATTTGGACAAGGTG
AATGGAC
View all "lgc20" genotypes
PI152702   bicolor, NULL Sudan   lgf7 AATCTTTATTTAGCTACTATATGTTGCTTGCAAAAGCATTGTTTGATGCT
TGCCTTTCCTCCAACAAAATTGCATATATCCCAAGGCAAAACTGAAAACT
TAAGATTTTATTGCCTTTTGAAATGTGCCATTCAAGAACAGGATTGATGT
TTCAAATCTGCCTTGTGCAGATGTACGCAATGCTAGAACGAATTAGCCCA
AGGACAAGGAAGTTGGAACTGTTTGCAAGAATGCATAATACACAAGCTGG
GTGCGGACTAATCGTTGCCTCTCTTCTTGGCCAAGTTTTCTGTCTCATTC
TAACCAGATGCACACTATTATATTTCAACTTACATTTTTCTCCTGGGCAG
ATGGCTTTCACTGGGTAACCAATTACAAGGGGTAAGGCTTGTTGATGAAG
GGTTGAGAGCAAGGTACAAGGCTGCTTACCCCGATGTTGAGGTCCAGCCA
CTGTCTCCTCCCAGGACAAGCGCACCAATGGATGTTGACCAAAGTAGTTC
ACAGAAGGCTGCTGCGCCAGATGGTGGCGAGAGGCCCGCCTGATGCTTGC
AAACTTATTTGCAAGTCACCGTGTCAGGACCCACTACTGATCATATAGTT
TTCATCACTGTTAGCGTTACCCCTGTTGTAAAATTAGGCAGCTC
View all "lgf7" genotypes
PI152702   bicolor, NULL Sudan   lgh105 AATGCTGCACAGAACTGACGGATTTCAGTAAGTAGCTAGCTAGAGAACGC
TCCAATTATTCCTCCAAACATTAGACAAATGCAATAAAAAAACTAGGATG
AATTTTGTCCGATCATTTATGTTTCTTTTTTGGCAGCTGCCTTGACAAAG
CAGCAGTAGACACCGGAAAGGCTGGTGCCTGGACTCTCTGCAGCGTAACC
CAGGTGGAGGAGACCAAGATCATCCTCCGGATGGTGCCCATCTTCCTCAG
TGCTGTGCTCGGGTACATTCCGGTGCCGCTGATCCTCAATTTCACCGTGC
AGCAGGGCAACACAATGGACACCAGGCTCGGCGCAGTTCACATCTCACCC
GCAACGCTATTCGTCATCCCTACGGTTTTCCAGATGGTTATCCTCGTCGT
TTACGACCGGTTCATTGTCCCGTTCCTAAGACGAATAACCGGCTATGTGG
GCGGTGTCACGCACCTCCAGCGCATCGGCATCGGGTTTCTTTCGACCATA
GTGGCCACTGGCATTGCAGCCCTAGTGGAGGCCAAGAGGAAGAAGGTGGC
AGAAGACAGTGGCCTTGTGGATGCTACAACTGGAATTCCAATGTCTGTTT
TCTGGCTGACCATACAATACTTCCTTCTAGGTGTTGTGGATGTCACCTCC
TTTGTAGGGCTTCTTGAGTTCTTCTACAGTGAGGCGTCCATGGGGATGAA
GTCCATTGGGAGCTCCATCTTCTACTGCATCCTTGGGGTGTCTGCTTGGC
TGGGGAGCCTGTTGATCCAATTGGCAAACCGCTT
View all "lgh105" genotypes
PI152702   bicolor, NULL Sudan   lga15 AATGTGCAATA-----ATATGCAGGGGCATGGCGGTTGCCGATGCATCGA
GCCCGTACAAGGTGAAGCTGCTGGTGGAGGACTACCCATACGCGTCGGAC
GGGCTGGCAATCTGGCACGCGATCGAGCAGTGGGTGACGGAGTACCTGGG
CATCTACTACCCCAACGACGGCGTGCTGCAGGCGGACGTGGAGCTGCAGG
CATGGTGGAAGGAGGTGCGCGAGGTCGGGCACGCCGACCTCAAGGACGAG
CCATGGTGGCCCAAGATGGAGACGGTGGCGGAGCTCGTCAAGGCCTGCAC
CACCATCATCTGGATCGCGTCGGCGCTCCACGCCGCCGTCAACTTCGGGC
AGTACCCGTACGCCGGGTACATTCCCAACCGTCCGTCGGTCAGCCGGAAG
CCGATGCCGGCGCCGGGCAGCGAGGAGTACGCGGAGCTGGGGAAGAACCC
GGAGAAGGTGTTCGTGCGCACCATCACGAGCCAGTTCCAGACACTCGTCG
GCATCTCGCTGCTGGAGATCCTGTCCAGCCACTCCTCCGACGAGGTGTAC
CTCGGCCAGCGCGACACGCCGGAGTGGACGTCGGACGCCAAGGCGCAGGA
GGCGTTCCGGCGGTTCGGGGCGCGGCTGACCGAGATCGAGAGCCGCGTGA
TGACCATGAACGCCGACCCAAGTCTCAAGAACCGCAACGGGCCGGCCAAG
TTCCCCTACACGCTGCTCTACCCCAACACCTCCGACAAGAATGGCGATGC
CGCCGGCATCACCGCCAAGGGCATTCCAAACAGCATCTCCATCTGAGTTC
TGAGTTCTGA
View all "lga15" genotypes
PI152702   bicolor, NULL Sudan   lgh10 ACATTGGTTTCCTTTATCCTATGGTTAGTTGATACCCACCCATCTTGGTG
CAAACTAAAATTGAAGTGTATATTATCTGACATGAGGAGCTGAGGTGGGA
TGAGATGCTGATCAGACACTACCAAGGGAGAGAGGTTTGAAAATTAGCCT
GCTGCTGTTCTTCCCACTTGTGATTCTGGTTGGTGGAGTGCATGTTTGCT
TATGCTATGCGGGGATGTATTGGTGCAGTCATTGTGGAACCATCGCCGGT
TCCTTTCACACTGGTGGATACAGCGCTTGCTCACTGTTGAAGAAACCTGC
CTCTCAACGATGTCCCAGGTGGATCTATTTGTGACCCAGGAGATAAACCT
GCTGTCAGAGTGCTTGAATGACCCTGAGGATGAGTTTGATGAGTCACGTG
TTCAAGCAGAGCTTTCAGCACTCTACATCCTCTGGATATCAAAGGCAACC
ACTACCCGTTTTACCCAGTTTGCTTAATTGCTTAGTGCTGGTAGTTTGCT
AGGATAGATTCTTTTGCTCTCAAGTGAAGGATTCAGTTTAGTTTTGACTG
GGAAACTATTCGTTGGATGCAGCAAGTCCCGGCATTGAAAGGGAAGCTGG
AAGAGAGGCTGCATCCCATTTCCATGGGGAGGCTGCAGGACGTGATGGAA
AGAGCCTG
View all "lgh10" genotypes
PI152702   bicolor, NULL Sudan   lga110 ACCATTTCTCAATCCGTCTTGAAGGGTCAGCCGCGTGGCTGCTCTCGTGT
TGGTGATCGCGACACGCGAACCGATGCCCCGGCTGTTCTACGCAGCCGAT
CATACTGCGCGGCGCCATCCAAGTCCGTCACAACTTGGTAGATCCGGGTG
CCTTGTTGCGTTCTTTCTTAATACATGTCGATGGTTGTTCGACTAGCTGA
TGAACTCCCACGTCCTTGTGTCCTCGAGCTGCTAATTTCTCTTGTGTTTT
AAAATAATGGAAATTACATCTGTGTTGTGGTTTCTGCAGATGGAGGAGGC
TATGCTGTCGATCTTACTGTTGTTGAGCCTGCCTTGAATGTTGGTCCTGT
TAATCCGGCTGTACAGGTAGAGCATGGAGAGAATTTGGCAGTGCCAGGCG
ATACCCGTGTTAATTCTGTCGAAAATGCTGTGCTTTCAGAGGACACACTG
GTGCAAGCAGATCAGTTGTGCTCCAATGATGAGGTGCTGAGTGAGAACAC
AGAAGCTCTTACCAAAGACAGTCAGGTTGAGCTTTCAGGAGATCAGGGTG
GGTATCTTCCTCAGTCGGATGTTGATTCTGGAGTTCAGCCAGGGGAGAAG
GTGGAGAGTGAAGATTTGCCAAGACCACCAAGACTATCACGGGTTGCTCC
TCCTGATCTTGATGAATTCAAGACAAGAGCAATTGCTGAAAGGGGACCTG
GTGTTTCTAGTCAACCTGGTCATGTCATCCACCGAAGGGAGCCTAGTGGG
AAGTTGTATAATTATGCAGCAGCATCTAAA
View all "lga110" genotypes
PI152702   bicolor, NULL Sudan   lgc114 ACCCTTAGCTTCCTCCAAATCCATCGATCGTCACCATCCCGACCCCAATC
CCAGCCCCGCCCCGCCCCGCCGATGATGCAGCAGCACCAGCAAGAGGACG
ACCCAGCACCGCCACCCGCAGTCGCCGATCCCGACCCTCCGCCGCCCCCC
GACCGCGGTGATGCCGCCGCCTCCGCCTCCCGCAACGCCTCCTCCAAGTA
CGATTTCGTCAAGGTCAAGGTGTGGCTCGGGGAGAACGCCGACCACTACT
ACGTCCTCTCCAGGTTCCTCCTCAGCAGGATGCTCACCGTCACCAAGGTC
CACACTCACTACTAAGCAATTTCCTCTTTCCTTTCTTCTATCTATCTATA
TAGTAGGAGTACGTAATACTATCTCTATAATATGTCAATCAATTAACCCG
TCCATTGTTCCCCTT--ACACACACACACACACACAC----------GCA
GATTCCTAATCATGTCGCCATCAAGATTGCCCTTGAGCTCAAGAAGCTGC
TTGTCGACAACAGCCTG
View all "lgc114" genotypes
PI152702   bicolor, NULL Sudan   lgg112 ACCTTGCACAGGTATTGTGGTGGTTCTAGATTCCAAATCATTATATGCAT
CAAGTGTCACAAGCCATGAATCACA-TGAAATGATTAAAATTATATATTG
CTAAAATTTAACCAAATCTATCTAAAACATGCATGATTGGATTGTAGCAA
AATTTATGTG-TCATTCACACTATTTTGTTGTCCCCATGCTTCTGTCAGT
CTTGAATCCAATTACTGAACCTACTAACAAATGTCATTTTTCCTTGTGAA
GGTCATCTGACCACCAAGAGCGATGTGTACAGCTTTGGAGTAGTACTCCT
AGAAATGTTGTCAGGACGCCGCGCACTGGACAAGAACCGCCCAAATGGGG
AGCACAACCTGGTGGAGTGGGCTAGGCCATACCTGAGAAGTAAACGGCGC
ATATTTCGCATCCTGGACCCCCGGCTGGGTGGGCAGTACTCCCTTGCTAG
GGCGCAGAAGGCTGCAGCGCTCGCATTGCAATGCCTCTCAGTGGAGTCCA
GGCACAGGCCCAGCATGGACGAGGTGGTAACAGCCTTGGAACAGCTCCAG
GACACGAAGGAAGGTGGTAACCATCACCTAC
View all "lgg112" genotypes
PI152702   bicolor, NULL Sudan   lge107 ACTACATGGCAAAACGTCTAGAGGTACTTTTTCATTCAGTGACAGCATAC
CTTAGTGACTTTTGTTATATTCATCAAATTAGTTTAAAATTTACTTGGTA
ATGATCATTTTTGCAGAAACACTACCCAGTTTTGTTCCGTGGAGTCAATG
GAACTGTTGCCCATGAATTCATCATTGATTTAAGAGGATTTAAGGTACTT
GTATCTGAATCATACTAGCAATCCAACCATGCATCGATGCATTGCAGTCT
CTAACCGGCTCCTGGAACTTTGTCAGACGACTGCTGGTATAGAACCAGAG
GACGTGGCAAAGCGCCTGATGGACTACGGATTTCACTCACCAACCATGTC
ATGGCCTGTTCCTGGCACACTTATGATTGAACCAACTGAAAGTGAGAGCA
AGGTAAGCATATGTGGCTTTTGGTAATCTTTTGCTTCCCATTAATATCAG
TTAGTTGATTTCACATTAGCTTATGATATCA-TAACATTTTGTCGTCGCG
GCAGGCCGAGCTGGACAGGTTCTGTGATGCTCTTATCTCCATCAGGGAAG
AGATCGCAGAGATAGAAAATGGCAAAGCAGATGTGCTCAACAATGTCCTG
AAGGTAATATCTC---AGTGTCAAAAAATGGTATCAGTCAGGTAGCATTT
GTTCACCATATCAAGCCATATCTCTCTTCACATAGGTCCTTCTGAATCAT
ATTCCTTGCCTGTTGGGTCTGAATAACTTTAAAGAAAGAAGCGATCACTA
ACTGTAAAGAGTATGTGTCTTTTAGCATGCTAAGTCTTCCACACTGGAGA
TGGTTTCGCAGTCACACAGCC
View all "lge107" genotypes
PI152702   bicolor, NULL Sudan   lgh110 ACTAGATGACACAGCAGCTTTCAAGAACTTCAAGAAGTGAGTCTCAGATT
CCCAGGGACACCATTTCTTCATGTCATGGTTGGATTTACTCTTAATTATC
AATTGTGCAGGTGGGGAGATATAGAGTTCCCTCTACCTTTTGGAAGAGTA
CTCAGCTCTACAGAAAGTTTCATCCATGAACTTGATGAGAAGGTATTGAT
TGCAGAGCTATGTTTTTATCTTTCCTTTTTGTTTCTGAGGTCTATCACCT
ATAAAATAATCAGTTTCCATGAGAAATACTGGATCTGCAATACATTTTGT
TGACTTGTGTTGTTAATTCGCCAACCTTGTTATTTCAGACAAGTGCCTCT
CTGAAGTTCACAGTTTTGAACCCAAAAGGTCGTATCTGGACAATGGTTGC
GGGTGGTGGTGCTAGTGTCATATATGCTGATACAGTAAGCATCAATTTGT
ATCCTATTTTTATTTACACATAAAAAGATTTTCACGATGATGCCTGTTAA
ACTGTTCACCCATATTTAACTGCCGTGATGAAATTAATTCCCCCCATGTA
CCAGGTTGGAGACTTGGGATACGCGTCAGAGCTTGGAAACTATGCAGAGT
ATAGTGGTGCTCCTAATGAGGAGGAGGTTCTGAATTATGCCAGAGTTGTA
CTTGATGTAAGCAAACACTGTAACCTTGTCAATGCTGCTCTTAAGTCTTA
ACTCCACCTTTGGACCATCTTCTGGTGGGGACAATGTTAGGATCATCTGT
TAACTGTACAATTAAATGCAGTGTGCAACTGCTGATCCTGATGGCCGCAA
GAGAGCCCTTCTCA
View all "lgh110" genotypes
PI152702   bicolor, NULL Sudan   lga111 ACTTGCTCTTTAATGGATATATCAAAGTATCTTTACAGATGAAGTGAACT
ATGCCTAGTGTTGTTGTGTTGGAAACTGTGTCAGTTTATAGTGGTATGTT
GTCCTGCCTTCATTGGTATAATGCCTTTCTATGTCTGTACTAGATGACAT
GTTCTATGACTGAAGATGGCCTTTCCGAAAGTCTTCAAGAGATGGATTTT
TCAGGTATACCTTCCATCATTACTGCTAGACTTTTGGTGTTAGGATGGGT
GTGTTCTTTTCCATTCCTAATTATAGTGGTAATTCAGGTACCGACTGTTT
GCTGAACTCGGATGGGATTGATGAACTGCCAGAAGAATGGCTAGTTGATT
GCTCACAAGATAT---ACCTTGTTTACCTGCAGAAGAAATGTATGTGTTT
CATTCCAATATTCATAAGCGCTTGGATTTTTTAGTTGTTGAGTTCACTGT
CATTGAAGATGAAGTATTACTACTTATGGTATCT-AAACCTTCTTAGTAG
GAATAGCCCTGCTGCTGCCACGGAAAAAGCTGTCGATATCTCTGGTTGGT
ACAAACCTCTCATGAGATTTCATCCTTGCC--TTATAGCAGAATTCTAAG
TTGCTGATAGATGAATGCTATGCTTATTTTTCAGTGCATTCGAATTCTTC
GCCTCGCCAACAGTCCATCGTAGTCCAGAACAATCTTGCACAAGCTAGAT
CTACACCACTGAAAGGTGTGCCCAACTCTTGTCCATGTTTGCTTAAAGAA
TCATGATTTTTATTCTCCTTCTCAAGAACAG
View all "lga111" genotypes
PI152702   bicolor, NULL Sudan   lgh103 AGACAACTGATATTTTGTCTATGTAAGGAGCAAATTGTGCTTGTGTAGAT
ATAAGTAAAATCAACTGGCAAC--TGGTGAATAGTTCGTTTTCATCCTAG
TACATATATAGAGCAACAGGAAAAATAAGGTTTGGTTATCCAAGCAGCAC
ATCATGAAACAAGGGCGATAATGGGTGGTCAACTGATTTCTCTTTCAGAA
GACTAAAATATGAGCCTAGCCAGACAGCAGAAAATTTTCAGGCTTTCAAC
AGCTACGAATA----AGCAGAAACATAGTGAACTTTGAAAAAGGCATAGT
GACACAAAAAAGAACAGCTTTGTCAAAGTCACTTGCATGACCTCTACCTA
CCTAACTGCTGAAAACAACAAAAGGAGCACCAAGTTGCAGCACTCGGTAG
ATTCCTGCTAACATGCTTAGCAAGCTAAGGTCCAAGGCAAT---CAGTCT
CCAACGTTCAAATCGATACCCAATTCCTCCCTGAGCTGATGTTGCAATGA
CTCGTGACATGGACTGGACATTTGTATTAGAGAGGTGGCATCATGTAGGT
CCTCTTCTGGGG--AAAAAAATAGCTTGGCTATCTAAACAAGATTGGAAT
GATATT--------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
--------------------------------------------------
-------------------------------------TCCACCAGGGAAG
TT--------------ACGTTCAACACCCTTTGTTGTTGTTTCTTACCGG
CCTCATCACCCCCTGCCCTGGAGCAGTAGCAAAACAAAAGTGCCTAGAGC
AGTGTGGCATGCATGTTTTCTCTGCTATTTCTGAAGCATGCATGTTCTCT
View all "lgh103" genotypes
PI152702   bicolor, NULL Sudan   lgb4 AGATATGATGACTGGAGGTGTGGTTTTTGTCAGTGTACAGTGCATACAAC
CATACAAGCGATCATCAGATCATGGGAGTTCTCAAAAGGAAGATACAAAT
AGGATATTGCAATCTTAGGACACGAG---TCTTGAGGATAGTGAAGCATA
TTGGTGTGTGCATCTGATAGCAGCAAAGATCTCTCGAGTGCACTGGATCT
TTGCTTTTGAATCCTAGTATTCGCTAGCTGGGAGCATCCAACACTCAA--
--CTCTCTCTCTCTCCCAATCCCAACTTCCCAAGTGCTCTTGGAGCCGAT
CAGCCAAAAACTGCGTAAAGGTACGTCTTATTGTTTCAA---TCAATCAG
TAACATCAAAAGTTTACCCAATCACACAATACAGTGAAATGCGCACGAAA
ACCATTTGAGCTCCCCTAA--CGCTTTG-TTTGTTTCATACTACTGCGTA
ATTGTGCTCGGGCCTAGCTGCGCGTTGCTAGGAGCTACTACTTCATTATT
ATCCTCGCCTTTCTTCTTGCAACAAACACATGTCCACAACTCGCAGTGTC
CGTGATGGTAGCCCTTTCCATCGGCGCCCTGGCACTTGTTCACACATCTC
TTGTTCTTCACACAATAGTTGTCCCACAGTCGGAAGCACTTCCATTTTGT
CTTGGTGTCTCCAGGATCGTCGTCTCCCTCGCGCAGTGGTGACAGCTCTC
TTGCTGAATAGATCAAGATCACAAAAATCAATCAGCTCAATCATTTCACA
TACCAGTTATTTGATT
View all "lgb4" genotypes
PI152702   bicolor, NULL Sudan   lgf16 AGCATGACACAACAAGAGACAAGGTGTGCAACGGTGAAGCCACAACCTCT
AACTCAATAGAATGCAGTAATTCAGAGGAAACTCGAGGGTCATCGAGCCT
CCCTAACCTGAATGCATTTGACATCATTTCTCTTTCAACTGGATTTGACC
TATCAAATTTGTTTGAAGAAAAATATGGCCGGAGGGAAGAGAGGTTCACC
ACTAGGCAGCCAGCAGGAACAGTATTTGCTAAGCTAAATGAACTGGCTGA
GCGGTTAAAGCTCAAAATTAAGAAGAAAGAAAACGGGGTCTTGAAACTGG
CTTCACCAAAGGAAGGAATAAAGGGATTTCTCGAGCTTGATGCAGAGATT
TTTGAGCTTGCTCCTTCTTTCCTTCTAGTCGAGTTGAAGAAGACCAATGG
TGACACCATAGAGTATCAAAGGCTCGTGAAAGAAGAAATAAGGCCTGCAC
TGAAGGATATGGTCTGGGCATGGCAGAGCGACCGGCACCAGCAGCGCAAG
CAGTCTGTGCAAGGAGAGC
View all "lgf16" genotypes
PI152702   bicolor, NULL Sudan   lgf103 AGCGCAGCCGCAAAGAATGTAAACTTTCTTCTTCCTCCCCAGACGCACAG
CAGTAACAACAACTATAC------TCGTGGCTAGCTTGCTGTCTGCGTGT
CTTGTGATTTGACCCATCACTTTACAATGTCAGCATGGACACAGCGACAG
CATGTGTCTGGTGCTGGCTGCTTGTGCCTGGGTGTGGGCTGAGGCTCTGT
TTGCTGCCCCACCGGCACAGCCAAAGCATACA------------------
----------GATAGTGTTCGTTTTCAGTATTTGCTTCGAAGTACTCTAT
ACTAATGCGATCCTGATTTTGCATTGTCTTCCTCTCATTTGTGTTTGTTA
TCAGTGGGCCCATTTCCCACACATCCACTTCGGCCTCATGCCGGACCAGG
GCCTCAAGAAGACCTTCAAGACTCAGGTATCAAATATAAAACTGACATTG
AAAACCGTAGTAACTCGATGTATATTTGTATGTCTCCAAATCCTCACTTG
ACACTTTGACAGAATTCAGAGCATCCCCAGCAGCAACACTATATTATTAC
CATATATAATATTATATATATGCTTCTCTTGATGAGTTTAATTTAGTAAT
TCAATGTTTTGTACTTTGTAAGCACACACCCATCTTAATTTTAGCGGTTT
CCTGGGCTGTGAT
View all "lgf103" genotypes
[ Download ]