grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "PI152702" from the experiment "Hamblin, Casa, et al. (2006) Challenges of Detecting Directional Selection After a Bottleneck: Lessons From Sorghum bicolor. Genetics 173: 953-964.".

E.g., Germplasm L-WA58, Marker/locus pSB0080.

Items 1 to 25 of 200.       of 8 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
PI152702   bicolor, NULL Sudan   lgh4 CATGGAGAGCCTCGACCCGGATTACCACAACATGGCGAACGAAGCCTTGG
ACGCCCACGACAACTTTGGGATTGAGATCGCGCTGCGGGAGTTCAGGGAC
TTGTTTGAGGGGATTCAGTCCATGACTTACTGCTGCGGTACCTGTGGTGA
TGACAAGTTTGCCAGGGCCATTGTCCAGGCCTACCCGCACATAAAATGCA
CTGTGCTGGCACCTCCAAAGATGATTGCCAACAAACCGGCTGATGGGGTG
ATGATAAACTATGTTGAAGGTGACATGTTCAGTTTCATCCCACCTGCTCA
AACTGTGATGCTAAAGGTAAGAACCTGTTCAG--TCCACTAATTATGCTG
TGCTTTGGCTGCTCGAAATTACATGAACTAATTAATTCAAACGATCAAAA
TTCCA--GTGTGAGATTGAACTTTAATTTGAGCCACTACCACTTCCATAC
CTACTAAATGACAAACCGAAACATTCTCACTTTTAATGTTTATGACTTTT
GCAAGCTCAAATAGAGCT---TACCTTGAATGTTCACTGCATGATTTAGT
TACAAATTAATCATTGCGTACGTGT--AACGGTGTGTCCAATCTATGCAT
GATGTACTATATAGCTTGTGCTGCACCACTGGACTGATGAGGACTGCGTG
AACATCCTGGCTGCATGCCGGAAGG
View all "lgh4" genotypes
PI152702   bicolor, NULL Sudan   lgg101 GGTAATTATATCATAAATATAATGCAGCATGAGTTTGCAGTATGTTCATG
TGTCATGTATGCTGCCTGAATTCAGATGTTGCTGCCCTGAATATGTTGAT
GCAGAGTGCAAATTCATGAATGGAATGTGCTCAATGTTGGCAGGAGGACC
TGCCACTGTTGCCACGAGTGAATGGCACACATGCACAGTAATGGGGGCAT
CATAGCACAGCA---TAGAGTTGCTTTCAAACACCATAATAATAA---AT
AATGAATGATGATGC--------------------TGATTACTGAAGCCT
CTTGTTGCTTGCTTGCTTTACTCCCTTTCTCTTTAATCATGTCTAACCCC
AAATCCAGTGATATACACAGCCACCAATGCTGCGGGGCCAATCTCAAAAG
GGAAAGGGAAAGGAAAATCTTCTTCTTTTTTGAATCAAGGAGGGGAGCCA
AAATCTTGCGCAGCGGAGCTTACTTAACCACGCCATTTTCTAAGTTTTGC
ATTTTCTAAAAAAA----TGTACAACTCTAAGTTAAGAGCTAGTAACAGC
TAGCTAAACCTCTGCCACAAGAATCTAATCTGTCCGCAGATGCAGGTAAC
CTCGCGATCAATATCACCATGAAAAGTCTCTTGCCCGGTTGACTACATGT
CACAAGTCACAACACAGAAGCAGATCACAGCATCATCACATCCCTAAATT
ACCCGCCTCTCCAATTTCCCAATCTTCAGTTCAATCGTATGGGGACGATG
ACAAGTCAATCACCGGAGCTCTACTGCCATGTCTCG
View all "lgg101" genotypes
PI152702   bicolor, NULL Sudan   lgj106 CCATACAATTCTGGATACAGCTACACTTGCAGCTACCCTTTTTGTTATTT
ACATGATTCGGTTCAAACTGAGGTCAACATATATGCTGGACAAAGACAAC
TTTGCATTGTACTATGTGGTAAGAACCATATTAATCTCTTAACTTCAAGG
CAATGAGCATCTAGGGACCTTATACTGTCTTTTGCTCTGTAGAGTATAAC
CTGTATTTTGAATATGTATCCAGAAGTTGTAGTTTCAAAATGGCTATGCG
TTGTTTCACACTGCTCTGCTTGACCCAGAGTTTGTACTTTGTACCACCAG
CAAGAGCATTTCTGGCTGTATACTTTAGTCCCGCATGATCGCTATCACTG
CTTTGATGAATAACTTGTAGAAAGAATTTTATCTCAGATCTCAAATTGCA
TCTGTGCTGCTGTCTGTTTTTGGCCATTTTATTGTTTGCCTTTTTTTTCT
TGAAAGGAAAATGGCAGGGGAGGCCCCTAATGTGTTTTAAAAATGTCTCC
TATGGGCCACACATAGTATCTAACTATGTTTCCTTTCCAGGTATTGCCTT
GTGCTGTGCTAGCGCTACTTATTCATCCTTCAACATCGCACAACATAGTG
AACAGAATCTGCTGGGCCTTCTGTGTTTATTTGGAAGCAGTTTCAGTGCT
GCCCCAGTTGCGCTTGATGCAAAATACCAAGGTGAATATCTAAACATGCA
TTGGTGTTTGAAACAATATCC
View all "lgj106" genotypes
PI152702   bicolor, NULL Sudan   lgc4 CTACCATTTCGATTTGGCTGCTTGTTTGATTTCTATTTGTTCCGTTCCCT
TCTGAAATGGTTTGATTGAAAT-----------TAATGTTTGCTTTGGTG
ACATGTCATCGGATTAATCTGTAATAGTTTGTGTCCTGGAGGCGTCATAT
GACATTATAGCCTAGCATTTAGTTGGCAGAGTTCTCTATTTGCATATTGG
ACTATCAGCTTGGTTAACCAATTGGATGCATCTG--------TCTTATAG
CTCCACAAACAATATTAAGGGTGCACATTGGTACCTTTT----TTCCCCC
TTACTCTTGATTGCTTTGTTTTACACAAATATTGCAACACCAGTTGAGCA
TGTTATGGGATTGTTATCTGTATCTGGTAATAATTGTTCTAGTCAGGAAC
TATCTAGAGAATAGATACACTGACGGAATTACTTCATTAGTTTCTCCCTG
TGATACCGCAA---------------------------------TGGCTT
TGCCTCTTCTCAAAGGGAAAACGATGGCTTAACCTTGAACATTGAGCAAG
TTTTTACAGTATTATTATGGGCTGTGTGCCAACTTCTCCTGAGTTAAACT
GCTTAGACTGTTGAGGTCCGGGGGTCAA----------------------
-------------GAACATAGTTCTTAA
View all "lgc4" genotypes
PI152702   bicolor, NULL Sudan   lgj103 GGGCAACTTTGACCGTTGTAGGACTCTTTATGAGAAATATATTGAATGGT
CCCCAGCAAACTGTTATGCCTGGAGGAAGTATGCCGAATTGGAGAAGAAC
CTTAGTGAGACTGATCGTGCTCGATCAATATATGAACTTGCTATTGCACA
GCCAGCCCTTGATACACCAGAGGTTCTGTGGAAGGTATGCTCTCTTGCAG
AGTTGCTGTTGTATTCTT---------AGCTTATGCATGAATGCATGATA
TACATTATATGGTTTGTATAGTGATGTATAGTAGATGCGTTTTTTTTATT
CCTAAACCAACTGATCTAGTATTATAAATGATGTTGTAAATAGCTATTAT
GTTGCCCTAGTTACTAAAATCACCAGAGCTCATTTCTAGTGAACAGTTCA
TTGCTCGTTAGATGCCTTTAAGAGGCACCATCCTTCAGATACG
View all "lgj103" genotypes
PI152702   bicolor, NULL Sudan   lga105 TTCCACACGCACGC---AATCTTTATACCCCAGTCAATCATTCATCAGTC
ATCATCAAACGAGAACAGCGGCCCATACAGAG-TTTTCTGTTTATGCTTG
AGCGGCGGTTTAAGGCAAATCACGTGGCAC----TGCCGTTTTACACAGT
TGAATTTTGTTACTCCGTAGTATATACTCCTATAGTATACGTTAGTTGAA
TTGTTGTAATTTGAGACCGAACCGTCCAGCCATCCAAACTCCCTACAATA
TTAATTAGTGCCCTCGATCGATCGAGCCCTTGAAATAAAGGTAGCACACT
TCCATCTTCACTCTCACTCACTCACTC----TCACA--TGCACCATACCT
GACTTAGCCACCATGCATACACGCAAGACAATGGCCAAGCTCCTCAGCCT
CAAGACTTGGTACCAGCTCTTTGTGGACAACTTCCTCGCCATAGTCGCGG
TGGCATTTGTCGCCGCCGCGCTCCGGAGGGCATGGCCAGTCAGCGTCGAC
GATCTCGCCGGCAGCCTCCGCGCCGTGCCGCCAGTCCGCATCCTCACGGC
GGTCATCCTGACTGCTGGCGTTGCACAGCTGAGGCGATTGCGCCGGCCGC
GGGACGTGTACCTCGTGGAGTACGGCTGCTTCCGGCCCAAGCCCTGCTTC
CGGGCGCCGTTCGCCACGTGCCTGGAGCACGCCTTCTACCTGCCGTACCA
GGTCGACCCGGAGAGCGTCACCTTCTCGATCCGGCTGCTGGAGCGCTCGG
GGCTCGGCGAGGAGACGTCCCTGCCCATCTCGTACCACTACATTCCACCG
GA
View all "lga105" genotypes
PI152702   bicolor, NULL Sudan   lgh112 CATGC--ATGCTATATATGCTAGCCGACTATAATTCTGTCATCTACGTAC
GTATATTAGTAATAAGTACGACGACTTGATGACTATATACAGTGCTGACT
TCAAGTATATGTATGCTGTCCCACGTACAGCCCCATCGTGATGAGCGCCG
GCGAGCTAGAGAGCGGCAACGCCGGTGAGCCGGCGAAGCTGATCCGTCAG
CGCTACCGTGAGGCCGCGGACCTGATCTCCAAGGGCAAGATGTCCTGCCT
GTTCATCAACGATCTCGACGCCGGCGCAGGCCGCATGGGCGGCACCACCC
AGTACACGGTGAACAACCAGATGGTGAACGCCACCCTGATGAACATCGCC
GACAACCCCACCAACGTGCAGCTCCCGGGGATGTACAGCAAGGTGGACAA
CCCGCGTGTGCCCATCATCGTCACCGGCAACGACTTCTCCACGCTGTACG
CGCCGCTCATCCGTGACGGGCGCATGGACAAGTTCTACTGGGCGCCCACC
CGCGACGACCGCATCGGCGTGTGCAAGGGCATCTTCCGCACCGACGGCGT
CCCCGACGAGCACGTCGTCCAGCTCGTCGACGCCTTCCCGGGCCAGTCCA
TCGACTTCTTCGGCGCCCTCCGCGCCAGGGTATACGACGAC
View all "lgh112" genotypes
PI152702   bicolor, NULL Sudan   lga102 GATGCATGGCAATGCAGTACTACTAGCATGTAATGTGAAGCTGCTGCAGC
TAGCATCTAGCAAGCTGACGCCAAAGGCCCAAATCAAAAACTCAAAATAA
AACTAGCATCAATCATAATTCAGAAATGAAGCTTATGTGCAAGGAAAGTA
AACACACTTTTCCCCTTTTTTTACAAATAGAGCTTATATTTGGGAATATA
AAAGGAATGGAGGGAGGGAGGGATGTTTTCCTTTTTCAGAAGTATTGTCA
GTATTTGCAAGTCTCAAGTCTGTAATCTGTACCAGCA----GCAGAGTTG
AATGTTTGGTAGTTTTGGTACCGTTGCTGAGGCTGTTATTTATTCTGCAT
AGTACTCGTAGCACACTAGTACCAGTGTCTTTCTTCAGTAAATTCCAGCT
GGTATATGTGTATCCTATACTGTAAATACAGTCAAAAGTCAGCTCTTGTT
TCCTGGGATCTGATCAGAGATTAGCAGATATAATGAGCCGTTAAACAACC
TAGCAAATGCCGTTATAATAACAGAACTACAGTAATAT----CCCCGTGG
TCTCTCTCTGGAGGTGCATAAAAGCGCTGGCAGACTTGCTGCACACCCTG
ACTGACCTGCCGTGC-----CCTGACCTCGCCGTTTTCTTCTCTGCCGAT
CCTTTCCTTGCTTGCTGCATCTCTGTCTCTCTGTCTCTCAATGGCAGCCA
TCACCAGCAAGGACAAGGAGGAGGGTCTCCAGCTGAAGCAAGGGGAGAGC
AAGGTGTTCTCGAAGCTGTTCACCAGGGAGAGCTCCGCCGCGGCGCCGTC
CTTCCGGGTGTA
View all "lga102" genotypes
PI152702   bicolor, NULL Sudan   lge105 CAAATGAAGACATGTTAGAGCTTACTACTTGCCACTTGGTGTGACAGATC
CGCAGAAGCAGTATGCTGATGCTGTGATTGAAGTTCTGCCGACCCAGTTG
ATTCCCGGTGACAATGAAGGGAAGGTGCTTCGTGTTAAGCTCATCATGAA
AGAAGGGGTGAAGTTCTTCAACCCAGTTTATCTCTTTGATGAAGGATCGA
GCATCAGCTGGGTGCCTTGTGGAAGAAAGCTCACATGCTCTTACCCTGGC
ATCAAATTTGCCTATGGCCCAGACACTTACTTTGGAAAGGAGGTAATCCA
TCCCTGTTTATTTGTCCTCTTCATTCCCTCATGCAAAAGTTAGTTCTGTT
ACTTGGAATTGGAAACTAAATTGACACTGATAGCAACCGATCTGGTAGTC
TAAATTACCTCTTTTAAACTAGTGAACAAGAAATTGCTTGGCTGACCCAA
AGCTAGCTTTACAGAGTCAGCATTTGCTTGATGTGTTCAGGTATCCGTT
View all "lge105" genotypes
PI152702   bicolor, NULL Sudan   lgb110 TTTCCCCATCTGCTGCTGATCCTGGTGCTACTCTTGATCCTGGAGAATGT
CCGAGCGCAACCCAACAGACCACTTCTGATCAACTGCGGCTCGGGTTCAA
GCGCCGATGTCGATGGCAGGACATGGGTGGGGGACGCCCGTCCTGACGGT
ACCGACTTGACGGTCACATTGCCCGGAGTCATTGTCCCAGCTCCAAAACC
TGACGGAGGGGGAGGAGATGCGTACGGGGACCTCTACAGGACTGCTCGCG
TCTTCAACGCGTCGTCCACCTACAACCTCAGCGTCGCCGCCGGGAGCTAC
TTCCTCCGGCTCCATTTCAGCCAGCTCTTCAGCAACCTCAGCAGTGGCAA
GGAGTCGGTCTTCGATGTCACGGCCAATGGCCTGAGGCTGCTCTCCAAGT
TCAGTGTCCCCGGGGAAATCTTCTGGAGGAACGCGAGGAGCAACTCCACC
AGCGATGTCATTGTGAAGGAGTACCTGCTCAATGTCACCTCTGCAAAGCT
GGAGGTCGAATTTGCGCCGGATGCCGGGTCGTTTGCCTTCATCAATGCCA
TGGAGGTTGTGCCTGTGCCCGGCAACTCGATCTTCGATTCGGTCAACAAG
GTGGGTGGTGTTGGGGTGAAGGGCCCTTTCAACCTTGGAGAGAGTGGGAT
TGAGACCATGTATAGGGTGTGTGTGGGAGGTGGCAAGATTGAGAGGAAGG
AGGACCCGCGCCTCTGGAGGAAGTGGGATTCAGATGAGCATTACATATTC
GCTATGAATGCTGCTCGCAG
View all "lgb110" genotypes
PI152702   bicolor, NULL Sudan   lgf6 AAACAGTCGGAGGAGAAGAGGAGGATGGGCTTCGAGAAGCAGATCTTGAG
AGCCGGGACCGGCCCCAAGCCGGTAAAGGGCCAGAAGGTCACCGTCCACT
GCACCGGCTACGGTTCGCTCCTTCCCTTCATCCCATAGACCTCTGATTTA
CCACGTTGTTCTTGGATCCGCATCACTTCAGGGTTTAGAGTTAGATTCTT
TCAGATCCATGTCGTGTAGTAGCCTCGATGAATAAGCGGCGACCCTTTTT
TTCTCGGCTTTGATGCTTATTAGGATGCGATGTTCAGTCGTAGGGTTGAG
ATCGATCTGATCCAGAGTTGCAAGCGAACCTAGTGCACTGCATAATTCGT
TTCCTTTTCTTTTGTGTTATGACTATCACTATCTGATCTGCAGTAATTGT
TTGCTAACTTTTGCTTACTGCTATGGGTTTGTTTTCAGGGAAGGATCGTG
ATCTATCCAAGAAATTTTGGAGGTAAACTATCAATCTATTTTCTTGATTT
ACATCGAAGTGTAGCACATCAGTGGAATAAGCACGTGTACACTGAAAGTA
GTTCTTTTCCTGTCAGTCACTATGTTCTGTTGTTTCTTTCAGCACCAAGG
ACCCTGGGCAGCAGCCATTCAGTTTCAACATTGGTCTGGGTTCAGTGATC
AAAGGTAATCATGCCACATATCATCAGTTCATGTGAAGACCTTATAACTT
TGCCTGTTAGTTATCTTCACGTGTATTACTTTGTGATTTAGCAAGGGTTC
CATTACCTGATCATTCTGATTGCTTCCAGTCCGTATGTTATATTGGTATA
T
View all "lgf6" genotypes
PI152702   bicolor, NULL Sudan   lgc20 AATACCAGAATCTGTAATGATGCATGACTTTGCCATCACGGAGAATTACT
CTATTTTTATGGACCTCCCTTTGTTGTTCCGACCAAAGGTGTGTGGTATT
GGTGCACAGAAAACCTTCTTTGCATTTTCTTTCTGTGCTACTTATTTACA
TTCAGCTGACAGATGTCCTAGTCGATTTCCATTTAATGCACTCGGGAAAT
GCTTCAAACCCGTTTTCATAACTAGATCCTTATTGTTTTTTTATTGTTTA
CAGGAAATGGTGAAGAACGGTGAGTTTATCTACAAGTTTGATCCTACAAA
GAAAGCTCGTTTTGGTATTCTCCCACGCTACGCAAAGGATGAAAAAGTCA
TCAGATGGTTTGAACTCCCTAATTGCTTCATATTCCATAATGGTATGGCG
CCTTTAGCTTTCTGCTGAATGTATGACCTTTTTAGATTTTTCTTGAACCT
CCTTTTTTTTTGGCAAACTTGTGCTTCTCCTTTAGAAGCTTCTGATAGAA
TTATGCGACAGTATAAAGAACAGAACTCAAGCTAGATCCGTTTCCAATTA
CTGTGCTTGACTATGCAATTCCATGTATTGCACTTTCTTAGTTTGAGCTG
ATCTTTGAGGACATGTATTGTCACAGCTAATGCTTGGGAAGAGGGTGATG
AAGTTGTTCTCATTACCTGCCGCCTTGAGAATCCAGATTTGGACAAGGTG
AATGGAC
View all "lgc20" genotypes
PI152702   bicolor, NULL Sudan   lgj10 GCTTATATATCTAGCTTTAAAAAAACTGAAGCATATGCAAAAGAAAAA-T
ATAAATATAGCACAAAATGACCAGATATCTCGATTTCATTAGACCAAGCA
ACCTTTGGGGCTGCCAACTTTCCAGAGAAATAGGCACCATTCCAACACAG
AATTCACCACACCAATTTATCTAATCATTGTTCATAGAAATCCTTCCTAA
ATTGAGGTATCCCCAACAAATACGGTGCCCACAAAAAAAAATCTGCCCAA
AGAAATTAAGCCTTTATCTAATTTTCTTGTTTGAAATTGACGACTTAGTT
TGGATATACTTCAGTTTTGCAGAGCACTATGTTCCCTCCTCCCTCCCTCT
CTTGTGTCTGAAACTTAAACTG
View all "lgj10" genotypes
PI152702   bicolor, NULL Sudan   lgc18 CTACTCAAGCTAGATATTCCGATCACAAGTGGTCAGCTTACAGAGCCTGG
ATTTGGCTGTTTGGCGGAAGTAGATGGGAGTTTAGTTGCAGTAGGCACTT
TGGATTGGGTGCATGATCGTTTTGAAACTAAAGCATCACCTACTGAACTG
AGAGACCTTAGAAACCGGCTGGAGTCTATGTTGTCAAGTGAAGCATCATC
ATCAAATCAGTCAAAGTCAATTGCTTATGTTGGTCGTGAAGGAGAAGGAA
TTATAGGTGCTATTGCTATATCAGATATTTTACGAGAAGATGCAAACTTA
ACTGTGGAGAGGTATTTTCTGGAGTGATTGTTTGCATTTTAACTGTGTTT
TCTCGGTACAGATACATTTCTCTTATCCAACAGGGTTATCCTCAGAGGCG
TCGTGAAATGCTGCTGCAAGATTCTTAGATATTTTAATGTTATTTTTGAA
GTAGCATGCAA--------GTTTTGCAACTATTACTGCCTTATCTGTATA
GTTAAAGCAGTGCAGCATGTTTAAACTTGTCTTGTCTTGTTAATCATCAG
GTTGCAGCAGGAAAGCATTACAACGTTTCTACTGTCAGGGGATAGGGAAG
AAGCAGTGACAAGCATCGGGAGGACTATTGGAATCAGGGATGAAAACATA
GAGTCTTCCCTAACTCCGCAAGACAAAGCAAGCATTATATCAACTTTGCA
AGGGAAGGGACACAGAGTTGCAATGGTAATGAAATC
View all "lgc18" genotypes
PI152702   bicolor, NULL Sudan   lga1 TATCCATAGTAAGTAGGCAGCCCCTGATTCACAAGTCAGGACCAACGACA
TTCAGTTCTCTTGTTGCTTTCCCCTTTACCATCAAGTTGTAGTTTATGAT
GGAATACCATACCACTTGTTGCAGCTTTGTGTCCTTGATCCATCTAGTAG
TGGGTGTCGCATACTGCCTCGTCGGCTGGAGTGTCGGTCTCCCCAAGCGA
GCGGTAATTTGTACTGCAAACCTGCACATCCCCTCCCTCTTTAATTAAGG
ACTAGTACTTCCTGCAACTTGACCTCTTTGCCTAGTGAACAAAAGGGTTT
CTTTTATTATGTAATAAAAATATGTAGTGCCATCCAGTTATTTCCTTATG
GGAACAGATGAATGTATTTGTGCCATTACTTGAGCACAGCCCCTTCACGG
TTTCACCTAAGGGAATACATCTTTTTGTGCCATCTTGTTTTGTAGCCTAT
CAATGCCAATCTCCTGAAGCTGCTCTTTCCAGTGGCATTGTGCCATGGTA
TTGGTCACGTCACTAGCAATGTGTCCTTCGCTGCTGTTGCAGTCTCATTT
GCCCACACTATCAAAGGTACTTCTTTTCCTCCCATTTATATTTCAATGTG
GATTCTTCTTGCCCCTGTCCTGTTCACTCATGTTTCTATGCTACATACTT
GCAATGCAGCTCTGGAGCCCTTCTTCAGCGCAGCTGCTACTCAGTTTATC
CTTGGGCAGCAAGTTCCCCTCTCTCTGTGGATGTCTCTTG
View all "lga1" genotypes
PI152702   bicolor, NULL Sudan   prc0162 GCTTGTTTTAGCACTATGTGTTTTAGATTTTTGTATGAAAAATGTACAAT
TTGATTGTTTTTATTAATATATTTCCATAGAGCAGAGATCAATAGTTAAT
TAGTTTTCTATCTATAGTGTCTGTTATGTTTTCTCTGGTGTATCACTTA-
TTGTTTGAGTTTTATTCATCCAGGGACAAGAGGGTGAGGCAGCAGCTGAG
GAAGCAAAGAAGAGCAACCATGTGAAGAGGAAGCTTGAGAAGCGTCAGGA
GGGACGCGAGCTTGATGCGCACATTGAAGAGCAATTTGGCAGTGGAAGGT
TGCTGGCGTGCATTTCCTCCCGCCCTGGACAGTGTGGCCGAGCTGATGGG
TAAGAAATTGGACTTTCACATGACTTTCTTTGATTTACTAGAGCAGCATA
TCTGTTTTTATGCCTTTTGTAGCTTAAATCTTTATGTTTGTTTGTACCTT
ATTTATAATATAATCACTTGTGAATCTAGACATTTTAAATTTGTTAGCAG
CTGTCACAAATTT-ATCCTTCTAGGATAAGTATAATGTTGCACGCAGCTT
CTTACCATGC----TTCTTTTTT-TCTAACAGGTACATTCTTGAGGGTAA
AGAGCTTGAGTTCTACATGAAGAAGCTTCAGCGCAAGAAGGGCAAGGGCG
CCGCAGCTTAGAGCATTCTCATGGATGGTCTTACGCCGAAATGTGTGGCC
TATTAAATATTACTCTTGCTTTTTTGTTAGTCGTCTCAAGTTCAGAGCGT
CTATGTCATGTTTTGCAGACCTGAGAACACTATTTTCTGAAAATGAATCA
ACTC
View all "prc0162" genotypes
PI152702   bicolor, NULL Sudan   psb1430 CGACGGCTGCTCTGGATGGTTCAGGCCGCCTCGGACCTCGACGTCACCGG
CCGAGGCTTGTTGCGCTTGCGTCGTCGTCGCCGCCGGCCGGC--------
CAATCCGTAGCTCTAGCTCATCATGGGGCTACAGGGCTAGCGTTCCGTTC
TTGTGCGTGGTCATGCCTGC----GTGCCTGCGAGATTCATTCATAGCTC
TTTGGGCCGGCTGGACCAGATACTGACTTGTAT-ATGCATGCATGCATGG
CAGCGCTTACATCCTCGACTACAGCTCATCTGTACGTTGGTTGGTCGCCG
TCCGGTCAATGTCTCCGGTCTTCTTCTTAAAAAAGCTCTGATTTGGCGTC
TGATTATTGTCAGTGGACTACCTAGGTAGACAAATGCTGTTCACAAGTAA
TTGTATGATGGGGGTCGGGGGAATATAATCAGGGGGCCTCTCTGGACCCA
TGATAGGGAGTTTGCCTTTTGCATGCGATGGAGGAATTATCCAACTTCAA
GTGTAA
View all "psb1430" genotypes
PI152702   bicolor, NULL Sudan   lgh106 TCCTGTATCGAGTCCTCGGTTTTTTAACAGGTACTCCATCTATATTCAGA
TATCAGATACTGTTTTCTCATGTTAGTTTTTTGCAGTGATCTAACTAAAT
GATCACTCTGATGCACCAGGAGACACTCCACTGGACAGTCAACTCCAGAC
AGGGCTGGACCATCGGATATTCAGTCTTTCTCAGACTCCCTGAAGTCTCG
CTTAAATGCTGTCTCTATGAAGTATGGATAGTTTGTAATTTTGTTAATAT
ATTATTTTGTCTTGAGCCTTCTAGCATAATGAATTTTTATCCTAAAGTAC
TTTTGTGTGATACAGGTACAAAGAATCTATTACAAAGAGTACTCGAGGGT
GGAAGGAGAGACTCTTTTCACGCAATTCGTCCGTGGCGGATCTTGGTTCT
G
View all "lgh106" genotypes
PI152702   bicolor, NULL Sudan   lge102 GTATAGATGGATGGTGACAGAGCACAAACAAAGTCGCACACGATCGACGT
GCCCACAGAGCAGGGGGCATGGCCTGCTGCTGTGCTGCACTGCACCCACA
AACACACAACACAACACCGACTGCTAGTAGATGAGCCCCCGGAGGAGCAC
GGGA-----AGGACGACACGACGCCAACATCCCAGTACAATTATTATTGG
TTCCCATCAGTACCAGAACCACTAGCATATGGTGCCATGGCACTCGACTG
ACTGGCTGACTCAAA-------------CACACACACA-----GTGACGA
CACTGCTATACTACA------GCTAAGGGAATCCGTCCTTCCTCCGGGCT
GCAGTGCAGTGCA-----GGGGGTTATTATACAGCTCACTTGCAGGTGCA
GGGGTTGCAGCTGCAGTTGGGGCCGCACTTGCACCCGTCGTTCTCAGCTC
CGGCGCCGGCCGCCGCCTCGAACCCGCCCTCGGCGTGCCTGC--ATCCAT
CGTCACGTACCAGGCAAACACAGTCAGTACGTGCGCATGCGTGCTCTCAC
AGGAGTACTAGCTACATA--CATA----CATGTATAACAATACACAGCAG
CATATATACTGTGGATTTACATGATACAACGTGCAGGTAGGGGGAGCAGA
CGAGTGACCAGAGATCGATCTTTGTCATGTTCCCTACCAGAA--------
---------CGTATGCCGTGTCAAGACTTTTCAGTAC
View all "lge102" genotypes
PI152702   bicolor, NULL Sudan   lgb105 GTAA--TGTAAT----ATGAGTCTATATACAATAACAAGTGAAATGAACA
ACTCCGGAGACGACG-TACATGTGGAACCCATAAGCAGATTTGTCATGGA
CCACTGGCCCGTTTTTCCTGAGTTTTGGACGATAATTT-------GAGAG
--GCAAATCATCGCACTGGCCTTGTCATCACACATATATA--GGCATGGA
CG---GCGGTACGA-GGAGAGAACGACACACTGTACTATCTTGCAGGAAC
TTGTTTTATTTTTTTT---ATTTTGTTTTAGTTTTCGTTAATAAAATGGC
TGAACGT----------------AATAATTTCCTGATCAACTCTATTTTG
CTCATGG--ATGGTGTGCTCGATCATGGACGTACGCACGCACGCAGTGGC
CAGGAGCATACTGCGAGCAGACCAACGCTGGATGCTGCAAGCCGACGACC
GGCGTCTCGCCGGCGCGCGACTTCTACATAACGGGCCTCACCGTCTACAA
CGCGACCACCAACGCTGCACTGACGGAGTGCAGCAATCAAGCTCCTTACA
ACCCTAACCTGGTACGTCCGTAGACTCTCGCTCCAGCTCGATCGATCGCC
ATATATATATATATGCACATCTAGTGTT----GTCGTAGGTGTGACAAG-
------ACCTTTAATTTGTGTGTGTGT-----T--GCAATGTCCATCTCG
ACAGATTACCGGCATCGGCCTGGAGCAGTACTGGATCAACATCAA
View all "lgb105" genotypes
PI152702   bicolor, NULL Sudan   lgi110 AGGACCACCTTACAATAATACAGTTGCTGAGTAAGAATATCCATCCCCTT
GCCATCATGTAATAATTTATTTACAGTTAAAAGCCTTTGTATTATTATCG
GTAACATGACTTCTTTATTTTTGACAAAAAAAGGACCCGTCAGTTTCAGT
ATTGTTAAACAAAAATATTACATTATTCTTTACTGTTGTGCTGAACTGTC
CTTTCTGAAACATCAGTTATCAGAAGGTACTGGAACCGCTGGGTTTGAAG
GCCATTCTTATGGAAGACAATGAGGTAGCCATTAAACCACGGAAGGTACA
CATCGTTTTCTCATCATAAGTTATCTTACATAGTACAAAGACACTTCATA
TTGTCCAAGTTTCCGTCGTCATGGCTTGGCCACATTATCACATTCTTAAT
GCATGAGCACTGATGAGCTACTCAACAGGCATCTATACCTTCAACTATGG
TCACTTGATTTATTTACCTAATTATTTAAACCGTTTCTAGGGCTGTGAGA
AAATTGGGAGGTGGAGGAGATGTGCACACCAATCATCTCTGTGAGACAAA
GCAGTGGTATTTTCCTAAACAAACAAAGAAAAGAAGTAGACCATGTCGCT
GCCTCAATTATTGGATGCTTTGGTGCTCCTG
View all "lgi110" genotypes
PI152702   bicolor, NULL Sudan   lgf108 CCTACAAAACACTGATTAATGTTTATGGTGGCCCCAGTGTCCAGCTTGTT
AGTGATTCATGGATGTGTACAGTTGACATGAGAGCTCAATATCTACGAAG
TAAGGGTATATTAGTTTGGAAGGTAAAATATTATATTCTTGTTTCTTTTG
GTAGTTGGGCATAATTTTACTTTTGGTGATCGTGCATTTGTTTTATATTA
ATATATAAGTTCACCTATGAGAATTGCATGGCAATACATACTTTAACAGA
GTTGTTAAGAGTTGTAGTTGAGTCAAGTGACATTCCAAACTTCCAAAGCA
AATTGCCAGCTATTAAGGAGTTGATAAATGCCACCTCCTCAATTAGTATA
ATTTCCTTGATTTTTTTTCTTGACTAGATATGTAATGTTCTACTGAATTG
ATAAGATTTTAATTCATGAGATGCAATTTCCACATCATCCCTTGCTGCCG
ATCCCCCAGTTCTAAGTCACATATGTGGAATAACCAATTTTTGCATTAAC
TGAAAGTAGGTACCTATACAAATAAGAA--CATATATATACTCAGATGTC
TATCAGTTGGGTATGAAACAAATGTAATCTAAATTTTCTCCTTTCCTACT
TTTGCAAGCTGTATGTGCACAACTGTCAGTGAAGCTGTTTAAGG-AAAAA
AAAATGTTTGCAGCTGTAATGCAAGTATAGTCATTTGTATCTTCATCTTT
AGGTACATATAATATAATATGACTTCTGGCATTTAGTTGGATGTATGCTG
AATTCATGACAACATTTTTGTTGAGTATTTACTAACTGACTCT
View all "lgf108" genotypes
PI152702   bicolor, NULL Sudan   pSB0080 TTTCTCCATCGAAGCGGCCTCTTTTACGGAGCAACAAAAGGGTCTTAACC
AACAACCCAAGTAAGTGTTGAATATAAGCACACTATCAGTTGAAATATGC
CACTAGACACATGTTGACTGGCAATTAAGTGCCAAATGGCCCTTGCTGTC
AGCAGTTGAATTAGTAGAGTTCGAAAGTAAAGAGTATGTTGCGCTGCAAA
TTTCAGATAAGAGAAGATCTAGCACAGATCTCTCTGCAACTCAGCCACCT
CTGAAGAAGATGGCAACAGACGCAACAGCCAACTCCATGGCCTCAGCTTC
CATGGGAGGAAACATGCAAGGTGCCATGGATGGCTTTTCCAACCAGTTAG
CCAACCCTGGCATGATGCAGGCCTCGTCCTCTGGGCAGATGGTGGAGAGC
ATCCCATCAGCTGCAATCCGGAGAGATCAGGGAAGTGATCTCGCACAGAG
AGTTTCTGCAGTGCTTAGGCAAGCTTGGAAGGAGGATCAGGACACTGGTC
ATCTCTTGGGGTCTCTGTATGAGGTCTTCGGTGAAGCCATCTTCTCCTTT
GTCCAACCACCAGAGATATCCTTGTTTGTGTAGAGAGGAAATGCATAGGC
TCTGGG-TTTATTATTCTACGCTGTTGTACAACTAGGGATGTTTTGCAGA
GTTCACGAATGTAATGCAGGTTGTAGTTTAGTCAGTTACTGCATGTATTC
GTAACATATTCCAGTTATGTATGCTGTGCTGCTAAGTTATGTCACTAGTA
----TTTTTTTTCAAGTCCGGCTATCCACCA
View all "pSB0080" genotypes
PI152702   bicolor, NULL Sudan   lgc106 TTCTATTCTTCGCAGCGTTCTGAAACCTGAA-------------------
-----------------------------------------------ACT
GTGGCGGAAGTCGCCACGCACCGTTCTCAGCAAGCAAAGCGACCATGTAA
TCGCGTGAAAACAGACCACCAGATGTGTCCATGTGCCAAA-CAAGAGCGT
TTACAACTTGCTGCTAATCTACTGCGGCGTCTGCGTGCGTAGGTGACAAG
ATCACAAGATGCAGTTAGTGATGGTAGCCCAGCCCAGACAGCTGTGTAGA
GTCAAGGATGGATGGGTTGGGTTGGGTGCCACTGGGAATCAATGCCCAGT
AGCTGCACGAGTACGAAACCTTTTCAATGGAAAAGAGAACGGCGTGAAAA
ATTAGCTCCGAGAACGTT-GATGGTTGTACTTGTACGCCACGAGCCCGCT
ATGGAACTGGCTTTCTGGGAGAACGTACAGAAGATACGGTGACAGGAGAC
TGATAAGAATCCTTTTTCTAACGGGCTGAAGGGAAAAAAAAAAGTGTTTT
ACCTGAATGAAACCTTTCAACAAGGCGTTAAGCATGTCTTCCGGACAGAA
GGCATGTGTGCCACCTGACTGACTTCTCGATCCAAAATTATTTTGCACGC
ATTTTC--------GTTAGTGCAGCGGATGGGCGGCAACATTAAATGGCA
AACATGCTTATGCGACAGTTCTGGATTGATCA
View all "lgc106" genotypes
PI152702   bicolor, NULL Sudan   lgj7 TCGACCTCGACTGCGGCACGCAGGGACACCGCGAGTGGCTCGCCGAGGTC
TTCTTCCTTGGCCAGCTCCGCCACGACAACCTCGTCAAGCTCGTCGGCTA
CTGCTACGAGGACGACCACCGGATGCTCGTGTACGAGTACATGAGCAACC
AGAGCCTCGAGAAGCATCTCTTCAGAAGTGAGTGGTTTTAC---CAACGC
TCTTCATTTGTTTCACGTGTGTTGTGTGTGTGTGTCTTCATCGTTAACTT
TTTGCTAGTGGTACGGTCTGCAGTTAAT-------GGAATTAAGTAGAGT
GGTTAGCCAAACAATTGGGGTCGT---------------TTAATCATATT
TATTCAGAATAGCTTGGTTCTGACGAAGCATCGTGCCGACTGCGCGTGCG
TGCAGGTCTCGACGGCTCCATGCCATGGATGAGGAGGATGAAGATCGCCG
TCGGCGCGGCCAAGGGCCTCGCTTTCCTCCACGACGCTGACACGCCGGTG
ATCTACCGGGACTTCAAGGCCTCCAACATCCTGCTTGACGAGGTGAGCGA
TCCACGTCCAGCGTGGAAATTCTGCGTCTCTATTCTTTTCGTTGCGCTTA
CATGACATGCACTGGAGTCTAGTGGTTGGTAGTTTCGACGCTAGGAAAAG
CAGGGTCATTTCTGACGCATAC------GGCTCGCTGCTTTCCACGGCAG
CTTCTTTGCGTAGCTGTAGACAAGGATATAGTGACGACACCTACCTACCT
TTGTGGCTGCCTTAGCAGAATCAAAAAATTCATTCCCTGAATCGTCCATA
GGAAGATGGATGTCAAAGTCGCCTGGTTTCGATAGATGACCAGCCCCGG
View all "lgj7" genotypes
[ Download ]