grain_icon Diversity Home | Tools | SNP Query | Launch TASSEL | Download Data Sets | Tutorials | FAQ | Release Notes

Allele data for germplasm "PI152702" from the experiment "Hamblin, Casa, et al. (2006) Challenges of Detecting Directional Selection After a Bottleneck: Lessons From Sorghum bicolor. Genetics 173: 953-964.".

E.g., Germplasm L-WA58, Marker/locus pSB0080.

Items 26 to 50 of 200.       Previous | of 8 | Next

[ Download ]

Germplasm
Accession Name

Germplasm
Accession
Number

Subsp.
& subtaxa

Country of
Origin

Stock
Number

Locus
name
Genotype
View All Genotypes on
Marker
PI152702   bicolor, NULL Sudan   lgb101 AGTGAAATCGGCGTCAAAGAGGTTAGCTATTCTCGTGCCAGCCTCATATT
GAGTAATCCATAAGTTGTGTTTACTTGTTGCTTATTGTAGCGACTGCCAG
GCCCGTTAGAATTTAGATTAATATATTGCTTCTGTGTCTCTCCAGCTAAA
GGAAAGAGTGCATGAGCTACTGACCTCTCAGATGGCTCGGATCAAAGCTA
GCAAGGCGGAGCATGAAACACAGGAAATTAGGACTAGTGTTGTTTACTGA
AGTTTGACAATGAACACCCGAACATCCATGCTGGAAGTTTGTATAAACAT
TCCACTAATGTCGATGATGGTAACACGTTTCATCTGTTGTCATTTTACCC
ATCTGGAAAGGGTTGGTCAAATGCTAGTATGAATATGATTGCCCATTTTG
TTTCCCCCTACCATTGCCGTTATCCGTTCTTTAGTTGGGTATACCCTCCG
TCCCAAAAAGATTATCATTCTGGTTTTCTCCATGGCAGAAAGATTGTCAT
TTTTGTTTTCAAGAAGTCAATCGATCTCGAGTTTAATCAAAT-----ATG
C-AAAAAAAAAACAAATATTTATGATGAGTAGTAAGTATCTTCAGATAAA
TAATGAAATGGTTTTCAAAATAAACCTATTCGGAGTGAATTGACCGTAGC
TTAGTTGGTTAGTTTTATTCTGGTGGAATT
View all "lgb101" genotypes
PI152702   bicolor, NULL Sudan   lgb102 AAGCGCCACTTCACTTCGGACCTGACTACTTTGATAGTTTGATGAGTGCT
CAAGTAGGTCAATCTGTTTTTTGAGGCAAAGTAGGACAATCTGTTTTTTG
AGGCAAAGTAGGACAATCTGTTGTAATAGGAGCTGCTCTTCTTTTTCGGT
GTTAGGTGCTTGGTGCTAGGTGTTGGGTCGGTGGTAATCCTGGGATTACT
GTTGGCCGGTTGTGTACTTTAAACTCTACTTCCTCTCAATCTGTTGACAC
GGTCGCGAAAAAAGTAGGACAATCTGGACTTCCCTGTGCTTTGTAGTCCT
GCAGATTCTTAG--------------------------------------
--------------------------------------------------
TATTCTGAATATCTCAGTTTATTTAACCTTTGCAGCAGAAGATAGCAGTA
TGTTTGGTCCTAACTTAGATATACCCAATCTGAAAGCTTAAGTATTTTTT
GAAGAGAAGATGTCTGAAAACTTCAGTGACGACATGGGTTTCAGCTATAG
CAGTCTTACACGTCCTT---------------------------------
--------------------------------------------------
---AAAGACAGAGAAGATATTAATTCAATGTTTAGAAAGAATAGGTGCTA
TGGGCGCATCTTATCATTTATGTGGGGAGGGGAACATATATTGTGAAAAT
TGGAATATTCCCTTACTAATAAGTCTGTATGATTGTGACATATATGTAGT
AGTATATAAATACATCAAAGGGCAGCATGCATTTACATGTATTTAGCATG
CCAGCGCACTTCTGAAGAATGAAGTGTGATGAATGCTGAACAGATTGAGT
TCTGTTTCAGTTGTGATGAGT
View all "lgb102" genotypes
PI152702   bicolor, NULL Sudan   lgb103 TCCAACAACACAGAGGTCGAGAAGCCAAAGCACTGGACAAACAATATACC
CAAGGTTCTCATGATAGGCGGTGCCGTCGCCCTGGCTTGCACCTTTGACG
GTGGATTGTTGACCAAGGCCGTCATATTCGGCACGGCGAGAAGGTTTGCA
GGGCCAGGAGGGCCAGGAAGGCGGTAGGTGGATGGAGCTGGTTACCGTAG
AGCAATGCCACCCTTGTCATGTAGCAAAGCTATGCGTGGAAGTGCCCCAA
ACAATCTTTTTGTAGCAATACATTGCAGAGGACGGAATGCCGTGTCTAGA
TGTTCAGTGTAGACATCCTCATGCTGCAGATAAGGTGGTGTGCTCATATT
AGGTCAGTTGAGAAAATAGATCCTGCACATTCCAGAAAAGGAAATCGGCG
GAAAGATCCAGCGACACAGACCGGACATACATCTG-------TTGCTGCA
GTCGCCGCGGGTTAGAGCCAGCTGGTTAGGTTAGAACTATAGCATTATTT
TGAGGACAAGTGTGAAGAGTTGGTAAAGAGAACAGCCGTATGATGTAAGA
TGTACTAGGTTCATGTTACAAAATACACTGCTGTTTAGTAGTTAATAACA
AGAACAAGAATTCTGCCTTTTGTACCTATGTGGCATCTATTTGCTCGTCC
GGTCTTCCCTATGGATACTAGACGTTGACCTTTTGACAGTTGCTGC
View all "lgb103" genotypes
PI152702   bicolor, NULL Sudan   lgb105 GTAA--TGTAAT----ATGAGTCTATATACAATAACAAGTGAAATGAACA
ACTCCGGAGACGACG-TACATGTGGAACCCATAAGCAGATTTGTCATGGA
CCACTGGCCCGTTTTTCCTGAGTTTTGGACGATAATTT-------GAGAG
--GCAAATCATCGCACTGGCCTTGTCATCACACATATATA--GGCATGGA
CG---GCGGTACGA-GGAGAGAACGACACACTGTACTATCTTGCAGGAAC
TTGTTTTATTTTTTTT---ATTTTGTTTTAGTTTTCGTTAATAAAATGGC
TGAACGT----------------AATAATTTCCTGATCAACTCTATTTTG
CTCATGG--ATGGTGTGCTCGATCATGGACGTACGCACGCACGCAGTGGC
CAGGAGCATACTGCGAGCAGACCAACGCTGGATGCTGCAAGCCGACGACC
GGCGTCTCGCCGGCGCGCGACTTCTACATAACGGGCCTCACCGTCTACAA
CGCGACCACCAACGCTGCACTGACGGAGTGCAGCAATCAAGCTCCTTACA
ACCCTAACCTGGTACGTCCGTAGACTCTCGCTCCAGCTCGATCGATCGCC
ATATATATATATATGCACATCTAGTGTT----GTCGTAGGTGTGACAAG-
------ACCTTTAATTTGTGTGTGTGT-----T--GCAATGTCCATCTCG
ACAGATTACCGGCATCGGCCTGGAGCAGTACTGGATCAACATCAA
View all "lgb105" genotypes
PI152702   bicolor, NULL Sudan   lgb106 TTTTCTTAACCTCTTTTGGATTGGATGGTAGTGCCTTGATCTTAAGTTAT
CATGTTCTTAATCAATTCTTGGACCTTTAATAGGTTCACTGATGAGCTAT
CGCTGTAGTGCGTCACCTGCAGTTGGTGCGTCAGGTGCCATTTTTGGATT
GGTATGTCTACTTCTCCTCCCACTTGTGCTCGTTACCCAGTGCCAGAATC
ATGTTACCCCTATAGTGTGGTATAGTTCACTAGCAACGTGAAACTACAAA
CTACTCCATCCGTTCCAAATTA--------------TTTGTTATAAGTCA
AACATAACTAACTTTGACCAAGTTTATAGAAAAATTCATCAACATCTACA
ATATCAAATTAGTTTCATTAATTTCTCCATGAAACATGTCTTCATAGTGC
ACTTATTTGAACTTGTAGTTGTAAACAT
View all "lgb106" genotypes
PI152702   bicolor, NULL Sudan   lgb107 ATGGTTCCTCTTTAAGTGCAGTTTTTTCTACGTACATATATATGCAGTAT
GCGCCCCTGCTGAGTGGCATATGCATGTGTGTGTGCATACACATACACAT
TGCGCTTATACATATATTCTTGTGCAAATGATACATGTTCAGAACGCGGA
GCCTTGCCGATCGAGCAGCTCGCAGGTGTCAAACCACGAGCTGAGCAGCC
CGAGCCTGGAGTTCACGCTTGGGAGACCGGACTGGCAGGGCACGGATCAT
GACTAGCTACTGGCTATTAGCTAGCCATGTTTCGTGAAGCAGCTCACAGA
ACCTAGCTAGAAGGCTAATTTCTTCATTGAGGGTTATAGTAGCAGCAGTA
CTGATATCAGGAATGCCTGATGATCTCCAACTCGTAGGCGACAACGACAG
GTCTTCGCCTGCGAAGATGAACAATCAACCAACAAGTACAGCAGCAGCAG
CAGCAACCGCAGCATCTCGTCTCCACCGGTGTGGTCTTGTGGAGATGGGA
GTACGTGCCGATGGAGCACCGTACCGGGAAGAAACTAAAGACTTACTGGG
TCTCTCTCTC--------AGAGAGAGAGAGAGAGAGAAAGAGAGTTGA
View all "lgb107" genotypes
PI152702   bicolor, NULL Sudan   lgb11 GACTATAAGAGATTCCA---GGGACAGAAACTAGTTTTGTA---TTAAAA
TTCATA--TGATGGTTGCTGCAGGAGTTACTACAAATGTGGCCGCCGGCC
GGGCTGCCCCGCGAAGAAGCACGTGCAGCAATGCGACGCGGATCCGTCCA
AGCTGGAGGTCACCTACTTGGAGGCACACACGTGCGATGATCCACCACCG
TCGTCGTCCCATGCTGTTCCAGATCCGACGGCCGGCTCCGACGCTCTGCT
CGTACCACCAGTCCCGACCGTTCCGTTTCCATCAGCTCAGTGCTACGGCG
GCGGCCGACCGTCGCCGCCGCCGCTGCCGCC---GTACCAGGTGCCGTAC
GCCGCGACGACGCTCGGCTCCAACGTCCTGACGCTGACGGCCACCGGTGT
TCTTCTGCCTAGTGCAAGCTACGACCCTGTTCCGGATGTCACGGACTGCA
CGCCGTCGTTGGAGCAGGAGCAAGACCATGATCTGCTTCACATACCTTCG
CCGGCTTGTTCACAGTCAGAGCTGCTGCCGATGGAGGCTGCCAAGCTTTC
ACCGCACGCGCACGGGCTGCCTCTGTCGTTGGAGCACACGCTGGATTGCG
ACTTTGCTGTACCCGAGCTTTAATTAGCGTTCTTGATGTTAAAGAGTGTG
ATCGACCCTTTCACGGTAGCAGATTACATACAACAGCATCGATATTCTTG
TTTTCTGTACAGCTATTACTGTAATGCAATGCGATTAGAGTAG
View all "lgb11" genotypes
PI152702   bicolor, NULL Sudan   lgb110 TTTCCCCATCTGCTGCTGATCCTGGTGCTACTCTTGATCCTGGAGAATGT
CCGAGCGCAACCCAACAGACCACTTCTGATCAACTGCGGCTCGGGTTCAA
GCGCCGATGTCGATGGCAGGACATGGGTGGGGGACGCCCGTCCTGACGGT
ACCGACTTGACGGTCACATTGCCCGGAGTCATTGTCCCAGCTCCAAAACC
TGACGGAGGGGGAGGAGATGCGTACGGGGACCTCTACAGGACTGCTCGCG
TCTTCAACGCGTCGTCCACCTACAACCTCAGCGTCGCCGCCGGGAGCTAC
TTCCTCCGGCTCCATTTCAGCCAGCTCTTCAGCAACCTCAGCAGTGGCAA
GGAGTCGGTCTTCGATGTCACGGCCAATGGCCTGAGGCTGCTCTCCAAGT
TCAGTGTCCCCGGGGAAATCTTCTGGAGGAACGCGAGGAGCAACTCCACC
AGCGATGTCATTGTGAAGGAGTACCTGCTCAATGTCACCTCTGCAAAGCT
GGAGGTCGAATTTGCGCCGGATGCCGGGTCGTTTGCCTTCATCAATGCCA
TGGAGGTTGTGCCTGTGCCCGGCAACTCGATCTTCGATTCGGTCAACAAG
GTGGGTGGTGTTGGGGTGAAGGGCCCTTTCAACCTTGGAGAGAGTGGGAT
TGAGACCATGTATAGGGTGTGTGTGGGAGGTGGCAAGATTGAGAGGAAGG
AGGACCCGCGCCTCTGGAGGAAGTGGGATTCAGATGAGCATTACATATTC
GCTATGAATGCTGCTCGCAG
View all "lgb110" genotypes
PI152702   bicolor, NULL Sudan   lgb12 GGTATCCGCTTCGTTCTCTTCTCCAGGCCCCAACGTGGTCACCCCTGATA
TCTTGAAGGTGTGTGCCTGCCTGATGCTAATCGTCATTGCAACGTTCATC
GCACAGTTAAAAATGTCTTGCGGAAAT-TAATTTGTACAACGTTCAAACT
AATGCAGCCTGATCTGTCTGCACCGGGGATTGACATCATAGCCTCATGGT
CGCTGCTGTCATCGCCTACGGGCATCGCCAACGACACCAGGAAGGTTCAG
TACAACATCATCTCCGGCACATCCATGGCGTGCCCACACGCGAGCGGTGC
CGCCGCCTACGTCAAGTCATTCCACCGTGACTGGTCGCCGGCGATGATCA
TGTCTGCTCTCATCACCACCGGTATGTTCCATTATATCCCATGGCATCAA
AGATCGATCCATTCCGAGTTCTTTGTCAATACATCGCAACGCATGGTGCT
CGTCGTCATGCATATGCAGCCACTCCGATGGACACACCGGCCAACGCCAA
CACCAGCGTGCTCAAGTACGGCGCCGGGCAGCTCAACCCGGCAATGGCGC
ACGACCCAGGGCTCGTGTACGACGCATCGGAGAGCGACTACGTGGCTATG
CTGTGCGCGCAGGGGTACAACGCCACGCAGCTC
View all "lgb12" genotypes
PI152702   bicolor, NULL Sudan   lgb14 CGATCATCTTCTTCATTCGTCTCAATATATATATTCTCTGATCGATCGAT
CGATCAGGTCTCCATCCCTCGATCAGCTCTAGCTAGCTACCTTCTTGCTC
GATCGATCCATGATCACCGCAGCCGGCCACCGCGAGGCAACAAAAATCTA
GCCGCCGGTCGGCGATCGACAGGCCGCCCGCCGGCTGCGACGACGACGGA
CTACGTGGTCGC---CCGGATGCAAGCAACAGGCCACACTA---GTCCTT
ACAATGCCGCCGTGCCGCCTGTTGCTCACTCCATCGCCATCGCCGCCGAC
CACCGTCCTCCACCAGTGGTGAGTATTTCAAATTTTCAATTCAGTTATAT
TATAGCTATAGCTATTATGCCCATTAATTAATTTCATCAGATTATTA---
-GGACCACGCACGCACTATATGTTTATTTGCATTTTTGGAAAGAGGAAAC
ATGACAGCATTGCACTACCTCTACT---AGCCTGAGAGCCTGACTAGCTA
----CCATGCTGAGAGACTTGCGTTTGATTGGTTT---AACCGACTTCTC
View all "lgb14" genotypes
PI152702   bicolor, NULL Sudan   lgb15 GGCGGCACCCACTGGGTCCCCGTCGGACCCACCAAGGGCGGAAGGCTCTT
CGTCAACATCGGGGACCAGATCGAGGTGCTCAGCGGCGGCGCCTACCGGA
GCATCGTGCACCGCGTCGCGGCCGGGGACCAGGGCCGCCGCCTGTCCGTC
GCCACGTTCTACAACCCAGGCCCCGACGCCGTGGTGGCGCCGGCGGCCAG
CATCCGGCGGGAGGACGCCGACGCG---GCGGCGGCGTACCCCGGACCCT
ACAGGTTCGGGGACTACCTCGAGTACTACCAGGGCACCAAGTTCGGCGAC
AAGGACGCCAGGTTCCAGGCCGTCAAGAAGCTGCTCGGTTAAGCGATCGA
TCCAGCACCAGCAGCACCAGCTGCATTGCCAGAGGCCAGCAGGCAGCTAG
CTTATTAGTTCGTGGATTATGCGTTGCGTTGCGTTGCGTTTCGATTTCGA
GATTGCTTCTTGTTGATCCATTGTCGATCTGCATAGTATATGCACTGGGG
TCGCGTGTTTAAGT----------TTATTTAGCAAATCTTTTACGCAGTC
ATTACTGGTACTACGTACTTGTATTCAGCTGTGG--TTGACTATACAATG
TTGCGGCTTAATTAATTGCGCATCCCGTTTGGTGGACTTGCAGTCTTGCA
CATGC
View all "lgb15" genotypes
PI152702   bicolor, NULL Sudan   lgb17 AGGAGGA------TAATAATAATAGCCTACGTGGGCTCAAGTTGTTGCAG
CACAAGTCCATTTGTTACACTTGTGCCAACGGTACTGCCATACGCTATGT
GCTATAATCCTATAAATAATCAGTATTAGTACTATGTTAAGCATTTGTTT
ATTAGCTATTGTATGCATTAGAGCCCGAGATTAGTGAGCGAAATAAGGTG
TAGGTTTGTATATATACCTGCTTTTTCGCTCACAATTACTTGTCTAAATG
CTTGCTATTTATCTGTTCGATCACCCACCCTCTCTGAGCTG------TGT
AACTTTTTAATTTTGGAGGTTAGCATGTTTGTGCATTTTTTTTCTAGATT
ATTATAAGATTCCGCTGTATGGTACATCACAACATGAATGCCACCTTCCT
TGAATCTGCCTCCTTGGAAGATTTTCCCGTTAAATTATATGCTGTGCATG
CTTGTTGTGCAGAGATCTGTTTATAGCCCAAAACAACTATTATAAATCAC
TGATCTCCATGTCTGCTGTGTTGCTACAGTA-ATTTT---AAAACTATAT
ATAGTTCTGCAGTCCTTAAATGGTTCTTTTCAGTTTATT
View all "lgb17" genotypes
PI152702   bicolor, NULL Sudan   lgb18 ATTCACCATGGCTCTGTATTATACTGCTTCAAAATGGTAGCATTCTTCTG
CCTCGCTACGTATCCTACACTGTGGTCACGTCATATGTTACATTAAATAA
GCACATCCATAAATCACAGTAGGGCTCTTCTTTTCTCTCCTCATTGGAGA
CTCATGCATTACATGTTTCTCTATTCATATTCCTTCTGCAAGACCTCATC
TGAGAGACATAAACTCCAAGCTGCTCCGTCTTCTGTGGTTCATCAACATC
TAGTTTCAGCCTACTAGTAGTGTTTAGCTTTTGATGTAGGGCTCCTCCCC
GGCTCCAGCTCCGGCTTCTCTAGACGAGCCCTACCAAAAGTTTTGTAGGA
GGAGCCAAGTAAAAAACAAAGGAGCCGGAAGAGCCCCTCAGGAGGAGCCC
TGCCAAACACCCCTGTAGTCTCAAAGCAGCACCAACTCCAAGTTTGACCA
TGTTGATGGATCTCCCAAGTTGCCAACAAAGTGGGGGTAAAGTCCAACTT
GGAGCAAGGGACCTGCAC
View all "lgb18" genotypes
PI152702   bicolor, NULL Sudan   lgb4 AGATATGATGACTGGAGGTGTGGTTTTTGTCAGTGTACAGTGCATACAAC
CATACAAGCGATCATCAGATCATGGGAGTTCTCAAAAGGAAGATACAAAT
AGGATATTGCAATCTTAGGACACGAG---TCTTGAGGATAGTGAAGCATA
TTGGTGTGTGCATCTGATAGCAGCAAAGATCTCTCGAGTGCACTGGATCT
TTGCTTTTGAATCCTAGTATTCGCTAGCTGGGAGCATCCAACACTCAA--
--CTCTCTCTCTCTCCCAATCCCAACTTCCCAAGTGCTCTTGGAGCCGAT
CAGCCAAAAACTGCGTAAAGGTACGTCTTATTGTTTCAA---TCAATCAG
TAACATCAAAAGTTTACCCAATCACACAATACAGTGAAATGCGCACGAAA
ACCATTTGAGCTCCCCTAA--CGCTTTG-TTTGTTTCATACTACTGCGTA
ATTGTGCTCGGGCCTAGCTGCGCGTTGCTAGGAGCTACTACTTCATTATT
ATCCTCGCCTTTCTTCTTGCAACAAACACATGTCCACAACTCGCAGTGTC
CGTGATGGTAGCCCTTTCCATCGGCGCCCTGGCACTTGTTCACACATCTC
TTGTTCTTCACACAATAGTTGTCCCACAGTCGGAAGCACTTCCATTTTGT
CTTGGTGTCTCCAGGATCGTCGTCTCCCTCGCGCAGTGGTGACAGCTCTC
TTGCTGAATAGATCAAGATCACAAAAATCAATCAGCTCAATCATTTCACA
TACCAGTTATTTGATT
View all "lgb4" genotypes
PI152702   bicolor, NULL Sudan   lgb7 CTGATAGCATGTTAGCCGTTACATTTCACGCCCATTTCTATCTCCTAGCA
AAAAACAGAAAAAGTCATTCTCACCTCCTTAGGTGAGTGATGTAGACCTT
TAGGTGATCGGTGCGAATAGTAAACTTCTGCCAATTTTATCAAGCCTGTT
CCTCTGGGTTGCACTTAGCATTCACTTGAATATGCTGGGCATATCTGTTC
TTGCTGTCTCTACTGAAAGCACCCTTGACATTTAGGAATTGGGATTAATT
TATGCTGCTTTAGCAGCGCAGCAGTGTTGGGCCTATCAGATTCATTACTT
ATTACCTTTTAGTTCAAAATTTTGTGTATCTTTTATCACAGTGTACAGTA
AAAGTAACCGAGTCATATTGCTTATTTTCTAGCAAGTGGGTCATGATGAA
CCAAAATACACGGAGACTTCAGCGAGTCAGTGATGACGTAAGGGATGAGG
TGTTTATACATTGTCCAAAGACTCCAAGGTAAAGCGACTCACTTTTGTTC
TCAACATTCTGCATAGACATGCACTCTTGTTATTTCCATACATC-CATGT
GTCAAAAGTGCCCAAGTAGCTCTCTGCCCTTTTGGAACCCATGACTATTT
GAACTTTGAAGTTTTACACTCAGTTGGGTCATTTAA
View all "lgb7" genotypes
PI152702   bicolor, NULL Sudan   lgb9 TGGCTTGCAATGAATAAGTTTTCTGGATTCATCTATGTGCACTTTTAATT
TAGGATCTTCATAACTGCTTATGGTGCTTGATTTGTTTTTTTTTACTAGA
GTCAAAGTATGCTATCAAGATTATACCACTCTTTATCACAATTGATCCTC
AACGTGATTCACCTTCTCAGCTTAAGGCATACCTTAGTGGTAAGATATTC
TGCTATTGGGGTCAGAAACATTGAAATTTTAGGCTATGCTGCAAGTGATG
ATTCGCCTCGTTTTAACTGCAGAGTTTGACCCAAGAATAGTAGGACTAAC
AGGCCCCATCAGTGCAGTAAGACAGATTGCTCAGGAGTACCGTGTTTTCT
TTAAAAGAGTAGAGGAAGTTGGTCAGGACTATCTTGTAGAGAGCTCTCAC
AATATGTAAGTGCATGTTGTGCACCTTGCCATGTTGATGAATGTTTTCAG
ACATTGACCATCTGAAGTTACAGGTACTTGCTAGATCCATGCTTGGAGAC
AGTTAGGTGCTTTGGAACTGAGTATGAAGCATCAGACCTTGCTGAGGCGA
TAACAACA
View all "lgb9" genotypes
PI152702   bicolor, NULL Sudan   lgc1 TAATATGATTGTTATAGAGTTTATATATACTAAAATACTAGATTCAACAA
ATATGTTATCGACTTCACGTGAAACTTAAGGTGCCTGCCCTCACATCAAA
ATTTGAGTATTGTTTGCCTAAGCGAAGTTATTTTTTTCTTGGGCATATTT
CTCCATGGTTGCTTTTGTTGATGAGCAGAAGTGAGCATGTTTTGGCTATC
TAAACTCTGGAGTCTTGTCGTGCAGTTATATGCTTGAGTTTTTGGGCTGA
GGTGCACTACAACTCGATATATCCGGAAGGAGGTATTAGATGTCACCATT
TAGTATGTTGACCATGTTTGTTGAGTGTTTGATTTCATCATTATTATCTG
CTGCAGAGTTGCCGGTTTTGGAGAACAAAAAGAAAAGCTGGTGGCCCTTC
TAGCTAGCATTCCCAGGACGGGACAAGGAAAAAGATTAGAGCAGCTAGGG
ATCCCGAGCAGCTAACAGATAGGAGCCTTTCTGTTGGGCTATGTGACTAA
CTCATGGCGACGCGGAGGCCATGGGCAGTTGCGGCTTGCGCCTTTGACGG
CACTGCATTACCATTGTCATTGCCATAGGGGAGACATGTGCAGTACTGTA
CGTAGTAGTAGATGATACTCACTATCCCATTTGTACAGAGAGAACGAGGG
AAGAGCGAGACAGATAATCAGGCCATTAGCATAGTAATAGTAGTAATAAT
AATGTAATACAGGAGGGAGGAGAGGGTCATTCATTCATTGATTCATT
View all "lgc1" genotypes
PI152702   bicolor, NULL Sudan   lgc101 TGGAAAGCACATTCTTCATGCATATACTCCAGGGACGGAACCTTTCAGTT
TGTGGGAGGGATTGGACAGGAAAAGTGCAGAATATCGAAGATTGAAGGAA
GAACGTTCTGAGGTACGTACATGGGCTGGCAATTTTGATTCTTTGCCACT
ATTACTATTAGTAGTACCTAGTAGCAAATAAATGCATAATTTAGATATAT
TCTTAGAAGTCTCATCTGTGCACCCTTAATGGCCCAGTTCTTAAATGCAC
GTGCTCATTTGCGTTGTCTAAGCAAGATCTGTTATCAAAAGAGATGGAAT
AGTCAAAAGAGAGAAATGCCCCCACAGTTGGCACAGAAATCATCAAAATG
ACTCTCGTTTTTCAAAAAGAAGACCACTATCGAGTGTCCGTAAGAAGTAA
TAACTTTGTTGTCTTGACTGTGACTGACATTCCCATGCAAACTTTTCAGG
TGATGTGGAAAGCTGTGGAGCTTGCTCTTGGCCCAAAATTTAGCCGTGAA
AGATGCGACGTGAAATTGGTCGGGACACCACTAACGCACAAGAGATTTCT
CAGAAGGAATAGGGGAACCTATGGTCCAGCCATAAAAGCTGGAGAAGCCA
CTTTCCCTGGGCAAGCAACACCAATCCCCCAGCTCTTCTGCTGCGGTGAC
TCGACTTTTCCAGGGATTGGAGTGCCGGCGGTCGCGGCCAGCG
View all "lgc101" genotypes
PI152702   bicolor, NULL Sudan   lgc102 TGATACAGCTGGATCTAATCGTCTATATGCTACTGCTTATGCATGACAAT
TCTTCTTGCCATGAGTCACACAAGCTTTCAGTATAATGGTTTTCTGCTAT
CACCCTCCTGATTGATGGCATTTGCACAGCCCTATTTCCCTCTGTCCTTT
AGTAGGTAGCATCCGGATGTGGTGTTTCAGTTTGTGCGTAACTCAATTGT
TTAAGATATAATAACATTAGTATTGTTGCTGCTGCAGTTCACAAATATTG
TTGTTCAGTTTTGTTTGCACCGGTATCTGTTATTTATCGGATTCCTGACT
GAAAGGCACGCTTCATTCTACAATTCTAGTTGTCCCCCACAGCACCTTAG
CCCACATACTGGAAATGAGCACATATTTCCAGTTTACTTTAACAAGTTGC
AAACAAATTCTCGTGAACTCCACGTGGCGGAAAATATTGTTTCTTGATTG
TCACCTTTACACTTGAAAATATACCTTTTTGCCCTTGTCTTGGGATTGAT
TCTGTAGTTCTGGTCTAACACCTCTAGCTTGGTCATTTTATTATCTTTGT
GTTCTGACACTGAACAAAAAATGTCTGGCTTCTTTGGTCAGAGAGGCCGT
AAAATCAGGTTGTCTGTCTTCTTCATTATCCAAACACATTGATAAGAACA
CATCAATACTATAGTCCCTCCTGATGGTACTGTATCATGGAAAATGCTTC
ATTTGGTTGAATGTCTCCTGTATGTGTTATTGCTGGTACTGTGTATTGAA
TTTAAAGACGGTTGTTTTGTCATCTAGGAAATCACTTCAGCCTCCAGAAT
GGTGTCTACACCCA
View all "lgc102" genotypes
PI152702   bicolor, NULL Sudan   lgc103 GGCTATTGTCTCAGGTTTACTCAGCTTTTCACCATTTGCAGGAACGTATC
ATCAAGAGAGCTTTTGGGAAGTTAAAGCTAGAGCATGTGGTGATAGGGAA
GGGACAGTTTGAACAAGAAAGAGCAAAGCCTAATGTCTTAGCGGTAACCA
TTTCATCATAACTCCCAAGTATATTTAAGTGGTTACTACTGCGTAGACGA
CAACAAAACAAATACCATTGAAAAATTGTCGTTGGTGTCTTTTCCCATGG
GATGCAGGAGGGGGAGCTGCTGGCGCTGCTTAGGGACGAGCAGGACGAAN
AAGACCGGATGATCCAGACCGACATCAGCGATGAAGACCTCTTGAAGCTG
ATGGACCGCAGCGACCTGTCCGGACCACCTGGTGCTGCCGATGCCACACC
ACTGATCCCGCTGAAAGGTCCTGGCTGGGAGGTCGTGGTGCCAGCCAAGA
GCGGTGGCGGTATGCTCTCGTCGCTCACCAGCTGAGCGATGTCTGCACCA
TGTTTGGGTGCCCATTTTGCTAGCCACTCGTCAAGCTGACGATGAGGCGC
GTGCTGGCCGCTGATCAGGCGGATATTTTGCATATATGCCCCCGAAAAAC
TGTTGACCTGGGTGTTCAGCCTGCAGCAATAGGTTAGGCTGTGCTGTGAA
CTT
View all "lgc103" genotypes
PI152702   bicolor, NULL Sudan   lgc105 GGGAGTCCAGATTGCATCTGCTGATGAACAGGCAAAAGCTGCTGAGGAAT
TTAAGAAGACTTTATATGGTGTTGTTGACGATGGAAGTAGTGATGAAGAC
GAGTCAACCTCAAAGACTAAAAAGATACATATAAGGATACGTGATAAACC
GGCTGCACCTACTGTTGATGTCAACAAATTGAAAGAAGCCACTAAACAAA
TAGGCTTGGGTCCTCCTCCGCTGAGTAGGACAAGGTCATTATCAGGGACA
CCTCAAGACTTCAATCAGGCTCCTACACAACCAGGAGGTCCAGCAGCAGC
TGTTTCTCCAGCAATGCCAAATGCTGCAATTGATTTGTTTGGAACAAATG
CTTTAGTGCAACCGCAGGCACCCTCTAGTGCCACAGGTCCTGTTATTGCA
GGCATGGGAGTGACCGCTGGACCTATCCCTGAGGACTTCTTCCAGAACAC
TATTCCATCACATCAGCTTGCGGCTCAACTACCTCCTCCTGGAATAGTCC
TCTCACGAATGGCTCAACCTGCTCCTGGTATGGATCAAGGCCGACCAGTA
CCTAATCAAATGATGGCTAATGTTGGCCTTCCAGATGGTGGGGTCCCACC
ACAAGCACCACCGCAGCAGTCCCAATTTCCACCGCAGCAGTCCCAGTTTC
CACCGCAGCAATCCCAGTTTCCTCAGCAACCAGGCATTCCTATGGACTCT
ATTGGCCTGCCAGACGGCGGTGTTCCCCCACAGAGTCAGCCACTTCCTTC
ACAAGGCCAGGCTCTTCCTTCACAGGCACAGGGCTTTCAACCTGG
View all "lgc105" genotypes
PI152702   bicolor, NULL Sudan   lgc106 TTCTATTCTTCGCAGCGTTCTGAAACCTGAA-------------------
-----------------------------------------------ACT
GTGGCGGAAGTCGCCACGCACCGTTCTCAGCAAGCAAAGCGACCATGTAA
TCGCGTGAAAACAGACCACCAGATGTGTCCATGTGCCAAA-CAAGAGCGT
TTACAACTTGCTGCTAATCTACTGCGGCGTCTGCGTGCGTAGGTGACAAG
ATCACAAGATGCAGTTAGTGATGGTAGCCCAGCCCAGACAGCTGTGTAGA
GTCAAGGATGGATGGGTTGGGTTGGGTGCCACTGGGAATCAATGCCCAGT
AGCTGCACGAGTACGAAACCTTTTCAATGGAAAAGAGAACGGCGTGAAAA
ATTAGCTCCGAGAACGTT-GATGGTTGTACTTGTACGCCACGAGCCCGCT
ATGGAACTGGCTTTCTGGGAGAACGTACAGAAGATACGGTGACAGGAGAC
TGATAAGAATCCTTTTTCTAACGGGCTGAAGGGAAAAAAAAAAGTGTTTT
ACCTGAATGAAACCTTTCAACAAGGCGTTAAGCATGTCTTCCGGACAGAA
GGCATGTGTGCCACCTGACTGACTTCTCGATCCAAAATTATTTTGCACGC
ATTTTC--------GTTAGTGCAGCGGATGGGCGGCAACATTAAATGGCA
AACATGCTTATGCGACAGTTCTGGATTGATCA
View all "lgc106" genotypes
PI152702   bicolor, NULL Sudan   lgc107 CATGTGAGTTCTTGCTATGCCCAAACACGTGACGTGACCTTTTGTCTGTT
CCTAGTAAGTTGGTCGATCGATCGATCATTCAGGGCTGATGAGCTCTGTT
GATACTTGCTACTGCTGATAAGTGATAATCATCCGTGTGGCCATAC----
---CATTCAAATCATTGACAGGTGGGCTGAGATATGTAATGATTGGGTAC
GGTTCGATCCATATGCTCCCAACGCATCTGCATTCCTCCGTACTCAGAAC
TGAACAGCTTCTTTAGCCATGCAACTAGTGCAACTTCTGACAATCAAACA
GAAAATTACGGCTTCTATATGATGCAAGAAACCTTTACTCATGGGTCCAC
GAGATTTTGTTTAGGCATTACCTATTTATTGGTTTGGTTGAGACTTGAGA
CTTGAGAGGCTTGTAACCCATCAGATGTACCATTGCTATGTCATGTAATC
TTAAGTGAAGTAGGTCTAATATATTTAACAATGAAATAATGGATAGATGA
TTGTGCCCACATATGTGCTTGTGTGCACACAGCATGTTCTGCTTCTAATC
ATCGAGTTTTCTGGTGCTTTATTTCCGTACCTTCTTGATACAATTATATC
TAACGACAAATGGTTGTGTTATCATGTTTTCTTGATACAATTATCTCAAG
GACAAATGGTTGCCTTATCATGTTTGATCATTGACTTGCAGATATACAGC
ATATTCTGAGCTTCTGCCTATTCTAGCTGCTGGG
View all "lgc107" genotypes
PI152702   bicolor, NULL Sudan   lgc108 AGTTTTGCATTAGCCTTCTGTTTTTATTTCTTAATTTAGCAACATGATGA
AAGTTT-----------------------------------GTTGTCCCA
TCTTTTATGCAAAGTTTGTTGTCCCATCTTTTATGCAACACTAATATGGC
AAAAATAGCAATTTTTTACCGCATGCCACCAATTTTTTATCTGGTCATGC
TTGTCTCTATACACCAAATAAGCATAGTATGAAATATATTTCATTCATGA
TGACTCAATGATACTTGTATTGTAAATAACTAAATATGAATAG-TTTTTA
TGTAAACTTAGTCAGATTTTAGATGATTTGGTTTAGGGCAAACTAGAATG
ACTTTCTTTTTGGAAGGGATGGAGTACTCAGCTGTCATATTGGAACCTTC
ATCCGTGCATCAGATTTTATACGACCAGAGCTGTCACATTTGAGCTGATC
CATTTTCTCATACGATTGTCATACATTCCATTTCTTGTTATATAGTTTTA
ATTTGCAGTTTGGATTTACGAACAAGATCTCACCAATTGCTGATATTTTC
AGAGGTCCATGACGATTGCATTTGAATGAACCTTGGTTCATTTCTGCGGT
TTTGGTTTCACTAGAGGTTTTCTTTTATAGTGGTGGTTAACTGTTCTGGA
GGCAAGGGAGGGTCATCTTTACACTCATGGAGCCTTTTTCATTTTAACAG
TAGCGGTACAAGATTTTAAGTCAGCTGTAATTTTATAGTTATATGGGATT
TGCACGATTA----------GCTGTGTTTTCATGAAAGAAACTGAATATC
AGCTAGATTGACG
View all "lgc108" genotypes
PI152702   bicolor, NULL Sudan   lgc109 AGTATGATATATATAAGCAGACAAATTGTTCAGAATTGGACAGATAAATA
AACGTTTGTACATATTTTTGAAGTACCATACACTGTTT-TTTTCTATTTT
GGCCTGAGAACGGGCTGACAATTTTGGCCTAT-ACAAATATTAAGGCCTG
A--AAAAAATAGAATCAGATTATGAAATGGCCCGTGGGATATGATGTGGC
CCATTGCCATCCTCAGATGCAGATGTAGCAAGTCCTATGAATGTTTATTA
GCTTTG--G-TTTTTTGAATTAAAAGATCACTTGTCTGTAATGATTATTA
CAGTGGCCTGACCAATTCTAACTACACGGAGCTTACCCAGCTATACGAGA
TGTACAAGGACCAGGGTGAGTCGCATTTATTTGAGATACTGAATTTCTCT
CTCTGTTTTTTTGATGCCCAGTTCCTCATGTCGTAGATTGGTTCAGTTAT
GATTCATAGTATGCTATAAATTAATATTGCTGTAATTGGTGTGACCTTCT
TCAGGTTTTGAGATCCTTGCGTTCCCATGCAACCAGTTCGGTGGGCAAGA
GCCTGCCACGAGTGAGGAGATCGTCCAGTTTGTTTGCACTCGCTTCACGG
CCAAGTTTCCAATTTTTGACAAGGTAATAAATTTGTGCGCACAAAAC
View all "lgc109" genotypes
[ Download ]